Incidental Mutation 'R8278:Dchs2'
ID638054
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Namedachsous cadherin related 2
SynonymsLOC229459
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83127948-83357209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83271003 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1121 (I1121N)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
Predicted Effect probably damaging
Transcript: ENSMUST00000191829
AA Change: I1121N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: I1121N

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83325418 missense probably benign 0.01
R6007:Dchs2 UTSW 3 83346227 missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7462:Dchs2 UTSW 3 83346155 splice site probably null
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83354398 missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83269284 missense probably benign 0.16
R7544:Dchs2 UTSW 3 83355127 missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83356127 missense probably damaging 0.96
R7587:Dchs2 UTSW 3 83304515 missense probably benign
R7632:Dchs2 UTSW 3 83348050 missense probably benign 0.00
R7694:Dchs2 UTSW 3 83129482 missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83346206 missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83128057 missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7886:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83129725 missense probably benign 0.00
R8068:Dchs2 UTSW 3 83300438 missense probably benign 0.12
R8094:Dchs2 UTSW 3 83355622 missense probably benign 0.02
R8160:Dchs2 UTSW 3 83270805 missense probably benign 0.19
R8166:Dchs2 UTSW 3 83354333 missense probably benign 0.28
R8422:Dchs2 UTSW 3 83325263 missense probably benign 0.30
R8506:Dchs2 UTSW 3 83301174 missense probably benign 0.17
R8517:Dchs2 UTSW 3 83271112 missense probably damaging 0.96
RF012:Dchs2 UTSW 3 83355068 missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83271140 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCAGTTGGTACTCACAGTAG -3'
(R):5'- TAGGGCTCTCCTCAACGTTC -3'

Sequencing Primer
(F):5'- GGTACTCACAGTAGTTATTGAAAGCC -3'
(R):5'- GTTCAAAAACACCCTGTTCTGCAG -3'
Posted On2020-07-28