Incidental Mutation 'R8278:Loxl3'
ID638064
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Namelysyl oxidase-like 3
SynonymsLor2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location83034173-83052562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83048716 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 352 (G352C)
Ref Sequence ENSEMBL: ENSMUSP00000000707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
Predicted Effect probably damaging
Transcript: ENSMUST00000000707
AA Change: G352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: G352C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101257
AA Change: G352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693
AA Change: G352C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83048766 unclassified probably benign
IGL01370:Loxl3 APN 6 83049487 missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83048647 missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83050583 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83035593 missense probably benign 0.00
R1771:Loxl3 UTSW 6 83049909 missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83048977 missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83037488 missense probably benign 0.07
R3731:Loxl3 UTSW 6 83050671 critical splice donor site probably null
R4179:Loxl3 UTSW 6 83037584 missense probably benign 0.00
R5230:Loxl3 UTSW 6 83035794 missense probably benign 0.16
R5385:Loxl3 UTSW 6 83050612 missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83048037 missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83049882 missense probably benign 0.12
R5769:Loxl3 UTSW 6 83050600 missense probably damaging 0.98
R5771:Loxl3 UTSW 6 83035799 splice site probably null
R5802:Loxl3 UTSW 6 83049289 missense possibly damaging 0.67
R5831:Loxl3 UTSW 6 83049018 missense probably benign 0.01
R5945:Loxl3 UTSW 6 83037511 missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83048166 missense probably benign 0.00
R6687:Loxl3 UTSW 6 83050664 missense probably damaging 1.00
R7961:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8009:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83049259 missense probably damaging 1.00
R8373:Loxl3 UTSW 6 83048891 missense possibly damaging 0.89
R8411:Loxl3 UTSW 6 83050624 missense probably damaging 1.00
V1024:Loxl3 UTSW 6 83035738 missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83038480 missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83038578 nonsense probably null
Z1177:Loxl3 UTSW 6 83048160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTTGGGCATGGCATGTC -3'
(R):5'- ATGTTCTTGGACGGGCATCTC -3'

Sequencing Primer
(F):5'- ATGGCATGTCTCTCTTCTACAGG -3'
(R):5'- CCGAACTTCACTCAAGTGGATGG -3'
Posted On2020-07-28