Incidental Mutation 'R8278:Fgf6'
ID638065
Institutional Source Beutler Lab
Gene Symbol Fgf6
Ensembl Gene ENSMUSG00000000183
Gene Namefibroblast growth factor 6
SynonymsFgf-6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location127015586-127028187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127015818 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 78 (Y78F)
Ref Sequence ENSEMBL: ENSMUSP00000000187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000187]
Predicted Effect probably damaging
Transcript: ENSMUST00000000187
AA Change: Y78F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000187
Gene: ENSMUSG00000000183
AA Change: Y78F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
FGF 82 208 9.54e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene displayed oncogenic transforming activity when transfected into mammalian cells. The mouse homolog of this gene exhibits a restricted expression profile predominantly in the myogenic lineage, which suggested a role in muscle regeneration or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations appear phenotypically normal, but exhibit a defect in skeletal muscle regeneration following injury. Mutant myoblasts show decreased migrational ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Fgf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fgf6 APN 6 127024085 missense possibly damaging 0.90
IGL03290:Fgf6 APN 6 127024132 missense probably damaging 1.00
R2111:Fgf6 UTSW 6 127015760 missense probably damaging 0.99
R6113:Fgf6 UTSW 6 127015937 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGCTCTCGTCTTCTTAGG -3'
(R):5'- ACGTTACCCAGCACATCTTC -3'

Sequencing Primer
(F):5'- CTTAGGCGTCCTAGTGGGC -3'
(R):5'- AGCACATCTTCCCTTTAGAGTGCAG -3'
Posted On2020-07-28