Mutagenetix > Incidental Mutations

Incidental Mutation 'R8278:Lrrk1'

638067

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8278 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66278684 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1232 (F1232S)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: F1232S

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: F1232S

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145954
AA Change: F147S

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133
AA Change: F147S

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
low complexity region	124	137	N/A	INTRINSIC
Pfam:Pkinase	158	435	6.6e-46	PFAM
Pfam:Pkinase_Tyr	159	435	5.8e-40	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,882,474		probably null	Het
4930562C15Rik	A	T	16: 4,850,176	Q477L	probably benign	Het
Adcy10	A	T	1: 165,503,288	D40V	probably damaging	Het
Cab39l	T	C	14: 59,539,113	Y248H	probably damaging	Het
Casr	G	T	16: 36,515,649	D99E	probably damaging	Het
Cdh16	T	C	8: 104,618,475	E364G	probably benign	Het
Cep104	C	T	4: 153,983,665	T189I	possibly damaging	Het
Chd7	T	A	4: 8,862,485		probably null	Het
Chit1	G	A	1: 134,150,594	R380Q	probably benign	Het
Cpne2	A	G	8: 94,554,688	K174R	probably damaging	Het
Dchs2	T	A	3: 83,271,003	I1121N	probably damaging	Het
Fgf6	A	T	6: 127,015,818	Y78F	probably damaging	Het
H2-T10	A	T	17: 36,118,940	N320K	probably benign	Het
Heatr3	A	T	8: 88,156,733	N398I	possibly damaging	Het
Hrh4	T	C	18: 13,007,227	S60P	probably damaging	Het
Ikbip	A	G	10: 91,096,328	H278R	probably benign	Het
Jmy	A	T	13: 93,464,716	I394N	probably damaging	Het
Klhl8	T	C	5: 103,874,241	E314G	probably benign	Het
Lhx9	A	T	1: 138,838,586	C164S	probably damaging	Het
Loxl3	G	T	6: 83,048,716	G352C	probably damaging	Het
Mpnd	A	G	17: 56,012,469	T311A	probably benign	Het
Mpp7	A	T	18: 7,444,025	D132E	probably benign	Het
Nck2	T	C	1: 43,554,580	S316P	probably damaging	Het
Nckap5	T	C	1: 126,027,772	S348G	probably damaging	Het
Nyap1	C	T	5: 137,731,815	R790H	probably damaging	Het
Olfr1489	C	T	19: 13,633,594	T161I	possibly damaging	Het
Park2	A	T	17: 12,050,722	N421Y	probably benign	Het
Pdcd11	G	A	19: 47,106,297	V507I	probably damaging	Het
Pdzd2	T	C	15: 12,375,909	H1380R	probably benign	Het
Pgap1	C	T	1: 54,490,271	V763I	probably benign	Het
Pnmal2	G	T	7: 16,946,338	V416L	probably damaging	Het
Prpf4	T	C	4: 62,415,256		probably null	Het
Psmb5	C	T	14: 54,617,885	G36D	probably benign	Het
Ptprq	A	G	10: 107,686,378	S571P	possibly damaging	Het
Rap1gap	A	C	4: 137,717,437	S254R	probably damaging	Het
Rufy2	A	T	10: 63,007,693	D492V	probably benign	Het
Ryr2	C	A	13: 11,595,506	E4145*	probably null	Het
Sgsm1	A	G	5: 113,260,092	F898L	probably damaging	Het
Slc26a9	C	A	1: 131,761,776	A487D	possibly damaging	Het
Slc6a15	T	C	10: 103,394,029		probably null	Het
Smad9	A	T	3: 54,789,266	T251S	probably benign	Het
Socs3	A	T	11: 117,967,652	C193*	probably null	Het
Sox6	T	A	7: 115,476,964	D813V	probably damaging	Het
Taf2	A	T	15: 55,065,965	L65*	probably null	Het
Taf6	G	A	5: 138,179,835	A468V	probably benign	Het
Tmem71	T	C	15: 66,555,112	D78G	probably damaging	Het
Tob2	T	C	15: 81,851,087	N227S	probably benign	Het
Trim34a	C	A	7: 104,249,416	Q180K	probably damaging	Het
Ugt1a9	T	C	1: 88,071,656	L276P	possibly damaging	Het
Wdr33	G	A	18: 31,827,352	R23Q	possibly damaging	Het
Wnt7b	T	G	15: 85,543,686	N189H		Het
Zfp609	G	A	9: 65,697,522	A1308V	possibly damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAAACGTGCTGGCTATGACC -3'
(R):5'- GTAGCCACCATACAGAGCAG -3'

Sequencing Primer
(F):5'- GGCTATGACCCCGTTACCTG -3'
(R):5'- ACTGAGATTGCATAGGCTGTAC -3'

Posted On

2020-07-28