Incidental Mutation 'R0724:Zfp697'
ID 63807
Institutional Source Beutler Lab
Gene Symbol Zfp697
Ensembl Gene ENSMUSG00000050064
Gene Name zinc finger protein 697
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R0724 (G1)
Quality Score 88
Status Validated
Chromosome 3
Chromosomal Location 98289278-98508893 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98335482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 416 (W416R)
Ref Sequence ENSEMBL: ENSMUSP00000136417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056096] [ENSMUST00000178372]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000056096
AA Change: W416R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056979
Gene: ENSMUSG00000050064
AA Change: W416R

DomainStartEndE-ValueType
low complexity region 83 96 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
ZnF_C2H2 202 224 3.72e0 SMART
low complexity region 245 268 N/A INTRINSIC
ZnF_C2H2 280 302 3.63e-3 SMART
ZnF_C2H2 308 330 1.76e-1 SMART
ZnF_C2H2 336 358 6.78e-3 SMART
ZnF_C2H2 377 399 2.57e-3 SMART
ZnF_C2H2 405 427 2.09e-3 SMART
ZnF_C2H2 433 455 7.26e-3 SMART
ZnF_C2H2 461 483 6.42e-4 SMART
ZnF_C2H2 489 511 2.91e-2 SMART
ZnF_C2H2 517 539 9.73e-4 SMART
ZnF_C2H2 545 567 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178372
AA Change: W416R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136417
Gene: ENSMUSG00000050064
AA Change: W416R

DomainStartEndE-ValueType
low complexity region 83 96 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
ZnF_C2H2 202 224 3.72e0 SMART
low complexity region 245 268 N/A INTRINSIC
ZnF_C2H2 280 302 3.63e-3 SMART
ZnF_C2H2 308 330 1.76e-1 SMART
ZnF_C2H2 336 358 6.78e-3 SMART
ZnF_C2H2 377 399 2.57e-3 SMART
ZnF_C2H2 405 427 2.09e-3 SMART
ZnF_C2H2 433 455 7.26e-3 SMART
ZnF_C2H2 461 483 6.42e-4 SMART
ZnF_C2H2 489 511 2.91e-2 SMART
ZnF_C2H2 517 539 9.73e-4 SMART
ZnF_C2H2 545 567 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,573 (GRCm39) E136G probably benign Het
Adgre4 T A 17: 56,159,281 (GRCm39) S655R probably benign Het
Ak7 T A 12: 105,676,513 (GRCm39) V71E probably benign Het
Ank2 C T 3: 126,755,986 (GRCm39) R1077H probably damaging Het
Anxa3 A G 5: 96,976,607 (GRCm39) T198A possibly damaging Het
Atp1a1 A T 3: 101,499,755 (GRCm39) I109N possibly damaging Het
Camta1 A G 4: 151,162,349 (GRCm39) I119T probably damaging Het
Carm1 A G 9: 21,498,670 (GRCm39) Y504C probably damaging Het
Casp1 C T 9: 5,303,077 (GRCm39) P177L probably benign Het
Ccdc122 C A 14: 77,329,517 (GRCm39) probably benign Het
Ces1a A G 8: 93,766,141 (GRCm39) S158P probably damaging Het
Ces3a T A 8: 105,776,827 (GRCm39) D103E possibly damaging Het
Clstn1 A C 4: 149,728,081 (GRCm39) D583A possibly damaging Het
Corin A G 5: 72,490,138 (GRCm39) probably benign Het
Cryba1 T C 11: 77,610,283 (GRCm39) D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 (GRCm39) probably null Het
Dis3l T C 9: 64,214,408 (GRCm39) T1027A possibly damaging Het
Dop1b A G 16: 93,559,213 (GRCm39) E653G probably benign Het
Dst A G 1: 34,227,758 (GRCm39) I1459V probably benign Het
Dyrk3 T C 1: 131,057,877 (GRCm39) T64A probably benign Het
Emp2 C T 16: 10,102,479 (GRCm39) C111Y probably benign Het
Enam A G 5: 88,649,853 (GRCm39) Y454C probably damaging Het
Fbn1 A T 2: 125,193,984 (GRCm39) C1328S probably benign Het
Gata3 T C 2: 9,879,386 (GRCm39) T197A probably benign Het
Gm1043 A G 5: 37,344,573 (GRCm39) T212A probably damaging Het
H2-Eb1 T C 17: 34,534,006 (GRCm39) probably benign Het
Hand1 T C 11: 57,722,506 (GRCm39) H36R probably damaging Het
Hmgcs2 C A 3: 98,204,317 (GRCm39) Y239* probably null Het
Hoxc12 A G 15: 102,845,490 (GRCm39) Y68C probably damaging Het
Inpp5a A G 7: 139,096,579 (GRCm39) I143V probably benign Het
Klhdc2 C A 12: 69,343,822 (GRCm39) F18L probably benign Het
Kpnb1 T C 11: 97,069,130 (GRCm39) Y251C probably damaging Het
Lrch4 A T 5: 137,635,570 (GRCm39) N315I probably damaging Het
Map3k10 A C 7: 27,367,780 (GRCm39) V286G probably damaging Het
Myo7b G A 18: 32,138,602 (GRCm39) probably benign Het
Nlrp2 G T 7: 5,322,221 (GRCm39) L809I probably damaging Het
Oacyl T C 18: 65,870,896 (GRCm39) probably benign Het
Or4q3 A G 14: 50,583,374 (GRCm39) V175A possibly damaging Het
Paxbp1 T A 16: 90,833,424 (GRCm39) D270V probably damaging Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pira13 T C 7: 3,819,871 (GRCm39) N564S possibly damaging Het
Plcb3 G A 19: 6,940,760 (GRCm39) R359C probably damaging Het
Plcxd3 G A 15: 4,546,350 (GRCm39) S118N probably damaging Het
Ptpn14 T C 1: 189,583,144 (GRCm39) S664P possibly damaging Het
Sirt1 T C 10: 63,159,752 (GRCm39) I443V possibly damaging Het
Slc7a8 G A 14: 54,972,643 (GRCm39) probably benign Het
Smim14 A G 5: 65,610,682 (GRCm39) probably benign Het
Sost C T 11: 101,857,744 (GRCm39) C19Y probably benign Het
Tcaf1 G T 6: 42,652,301 (GRCm39) A727E probably damaging Het
Thoc1 T C 18: 9,963,829 (GRCm39) L144P probably damaging Het
Tmem132b A T 5: 125,860,485 (GRCm39) T577S possibly damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tshr T C 12: 91,505,060 (GRCm39) F666S probably damaging Het
Wdr1 A G 5: 38,698,205 (GRCm39) V192A possibly damaging Het
Other mutations in Zfp697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Zfp697 APN 3 98,334,846 (GRCm39) missense probably damaging 0.99
IGL02313:Zfp697 APN 3 98,332,766 (GRCm39) missense probably benign 0.01
IGL03055:Zfp697 UTSW 3 98,332,810 (GRCm39) missense possibly damaging 0.51
R2165:Zfp697 UTSW 3 98,335,330 (GRCm39) missense unknown
R2971:Zfp697 UTSW 3 98,335,617 (GRCm39) missense probably damaging 1.00
R5749:Zfp697 UTSW 3 98,332,780 (GRCm39) missense probably benign
R5954:Zfp697 UTSW 3 98,335,909 (GRCm39) missense probably damaging 0.99
R6253:Zfp697 UTSW 3 98,334,855 (GRCm39) missense possibly damaging 0.95
R8849:Zfp697 UTSW 3 98,334,943 (GRCm39) missense probably benign 0.38
R9300:Zfp697 UTSW 3 98,334,979 (GRCm39) missense possibly damaging 0.46
R9620:Zfp697 UTSW 3 98,335,182 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGCTCGCACTTGCTCAGCCA -3'
(R):5'- TTGTAGCGGAAGCCCTTGCCAC -3'

Sequencing Primer
(F):5'- cTTCGCATGCGGGGAGT -3'
(R):5'- ATGAAGCTCTTGCCGCAC -3'
Posted On 2013-07-30