Incidental Mutation 'R8278:Cpne2'
ID638071
Institutional Source Beutler Lab
Gene Symbol Cpne2
Ensembl Gene ENSMUSG00000034361
Gene Namecopine II
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94532990-94570531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94554688 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 174 (K174R)
Ref Sequence ENSEMBL: ENSMUSP00000045755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048653] [ENSMUST00000109537]
Predicted Effect probably damaging
Transcript: ENSMUST00000048653
AA Change: K174R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045755
Gene: ENSMUSG00000034361
AA Change: K174R

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 507 7.26e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109537
AA Change: K174R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105163
Gene: ENSMUSG00000034361
AA Change: K174R

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 506 8.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212550
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Cpne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cpne2 APN 8 94554753 missense possibly damaging 0.84
IGL02702:Cpne2 APN 8 94570023 missense probably benign 0.03
IGL03277:Cpne2 APN 8 94548372 missense probably benign 0.00
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0126:Cpne2 UTSW 8 94554933 missense probably damaging 1.00
R0135:Cpne2 UTSW 8 94554925 unclassified probably benign
R0167:Cpne2 UTSW 8 94568579 unclassified probably benign
R0661:Cpne2 UTSW 8 94556039 missense possibly damaging 0.78
R0671:Cpne2 UTSW 8 94548342 start gained probably benign
R4691:Cpne2 UTSW 8 94558221 missense probably damaging 0.99
R4856:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R4886:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R6632:Cpne2 UTSW 8 94554955 missense probably benign 0.00
R6699:Cpne2 UTSW 8 94563959 missense probably damaging 0.99
R6968:Cpne2 UTSW 8 94548502 missense probably damaging 1.00
R7117:Cpne2 UTSW 8 94555544 missense probably damaging 1.00
R7505:Cpne2 UTSW 8 94548466 missense possibly damaging 0.90
R7571:Cpne2 UTSW 8 94551780 missense probably benign
R7583:Cpne2 UTSW 8 94555581 missense probably benign
R7612:Cpne2 UTSW 8 94557420 missense probably benign 0.01
R7745:Cpne2 UTSW 8 94568684 missense probably damaging 1.00
R7845:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R8319:Cpne2 UTSW 8 94553412 missense probably benign 0.01
X0025:Cpne2 UTSW 8 94557451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACCTTGTCTTATTATGGGG -3'
(R):5'- AAACCCACAGCCGTGTTTCC -3'

Sequencing Primer
(F):5'- CATATTTCTCAGTTGGATGCACC -3'
(R):5'- ACAGCCGTGTTTCCAGCTG -3'
Posted On2020-07-28