Incidental Mutation 'R8278:Cdh16'
ID638072
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104618475 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 364 (E364G)
Ref Sequence ENSEMBL: ENSMUSP00000129663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect probably benign
Transcript: ENSMUST00000163783
AA Change: E364G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: E364G

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably benign
Transcript: ENSMUST00000211903
AA Change: E394G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect probably benign
Transcript: ENSMUST00000212882
AA Change: E394G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R0016:Cdh16 UTSW 8 104617632 missense probably benign 0.22
R1233:Cdh16 UTSW 8 104618482 missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1752:Cdh16 UTSW 8 104619873 critical splice donor site probably null
R1892:Cdh16 UTSW 8 104617999 missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 splice site probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 104619985 nonsense probably null
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
R7202:Cdh16 UTSW 8 104614148 missense unknown
R7413:Cdh16 UTSW 8 104619940 missense probably benign 0.00
R7460:Cdh16 UTSW 8 104622291 missense possibly damaging 0.88
R8017:Cdh16 UTSW 8 104616267 missense probably damaging 1.00
R8187:Cdh16 UTSW 8 104618238 missense probably damaging 1.00
R8261:Cdh16 UTSW 8 104615179 nonsense probably null
R8421:Cdh16 UTSW 8 104621970 missense probably benign 0.00
RF005:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
RF024:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Z1176:Cdh16 UTSW 8 104615185 missense probably damaging 1.00
Z1177:Cdh16 UTSW 8 104623440 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGTCTCAGTAGGAGCAG -3'
(R):5'- CTTCCGAATTCTATGCCAAAGC -3'

Sequencing Primer
(F):5'- TCTCAGTAGGAGCAGAGGGGC -3'
(R):5'- CGAATTCTATGCCAAAGCCAAATAC -3'
Posted On2020-07-28