Incidental Mutation 'R8278:Zfp609'
ID638073
Institutional Source Beutler Lab
Gene Symbol Zfp609
Ensembl Gene ENSMUSG00000040524
Gene Namezinc finger protein 609
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location65692391-65827564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65697522 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1308 (A1308V)
Ref Sequence ENSEMBL: ENSMUSP00000124089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159109
AA Change: A1308V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124089
Gene: ENSMUSG00000040524
AA Change: A1308V

DomainStartEndE-ValueType
low complexity region 83 101 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 386 405 N/A INTRINSIC
ZnF_C2H2 495 520 2.14e0 SMART
low complexity region 629 638 N/A INTRINSIC
low complexity region 657 667 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 1000 1020 N/A INTRINSIC
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
low complexity region 1329 1348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Other mutations in Zfp609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Zfp609 APN 9 65702763 missense probably benign 0.18
IGL01688:Zfp609 APN 9 65704025 missense probably benign
IGL01718:Zfp609 APN 9 65702400 nonsense probably null
IGL01860:Zfp609 APN 9 65702834 missense possibly damaging 0.82
IGL02441:Zfp609 APN 9 65703329 missense possibly damaging 0.92
IGL02490:Zfp609 APN 9 65703968 missense possibly damaging 0.92
IGL02614:Zfp609 APN 9 65702790 missense probably damaging 0.96
IGL02794:Zfp609 APN 9 65704320 missense possibly damaging 0.83
IGL02959:Zfp609 APN 9 65703393 missense probably benign
IGL02967:Zfp609 APN 9 65697619 missense possibly damaging 0.83
IGL03036:Zfp609 APN 9 65702645 missense possibly damaging 0.89
IGL03182:Zfp609 APN 9 65701005 missense probably benign 0.02
H8441:Zfp609 UTSW 9 65794887 missense possibly damaging 0.82
R0304:Zfp609 UTSW 9 65701188 missense possibly damaging 0.89
R0487:Zfp609 UTSW 9 65702634 missense unknown
R0505:Zfp609 UTSW 9 65703462 missense possibly damaging 0.92
R0684:Zfp609 UTSW 9 65731201 missense probably benign 0.01
R1480:Zfp609 UTSW 9 65703311 missense possibly damaging 0.82
R1507:Zfp609 UTSW 9 65794777 missense possibly damaging 0.92
R1579:Zfp609 UTSW 9 65704472 missense possibly damaging 0.90
R1655:Zfp609 UTSW 9 65703554 missense possibly damaging 0.46
R1692:Zfp609 UTSW 9 65795311 missense probably damaging 0.98
R1701:Zfp609 UTSW 9 65731000 missense probably benign 0.05
R1735:Zfp609 UTSW 9 65703092 nonsense probably null
R1883:Zfp609 UTSW 9 65794758 missense probably benign
R1970:Zfp609 UTSW 9 65795277 missense probably damaging 0.96
R2059:Zfp609 UTSW 9 65704434 missense possibly damaging 0.83
R2302:Zfp609 UTSW 9 65794897 missense possibly damaging 0.66
R3404:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R3405:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R4514:Zfp609 UTSW 9 65703695 missense possibly damaging 0.46
R4533:Zfp609 UTSW 9 65703608 missense probably benign 0.00
R5043:Zfp609 UTSW 9 65700827 missense probably damaging 0.97
R5499:Zfp609 UTSW 9 65702855 missense probably benign 0.00
R7081:Zfp609 UTSW 9 65702441 missense possibly damaging 0.46
R7514:Zfp609 UTSW 9 65706136 missense probably benign 0.05
R7677:Zfp609 UTSW 9 65697174 missense possibly damaging 0.61
R7684:Zfp609 UTSW 9 65731080 missense possibly damaging 0.66
R8229:Zfp609 UTSW 9 65703500 missense possibly damaging 0.66
R8266:Zfp609 UTSW 9 65703714 missense possibly damaging 0.66
X0028:Zfp609 UTSW 9 65697080 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCAGGGTATCTACAAATAGAGG -3'
(R):5'- CTGACCCTTCACTAGAGCAG -3'

Sequencing Primer
(F):5'- GGAGTGCCCTTATGAGGC -3'
(R):5'- ATTTCCTCTGACTGCTTGATTTC -3'
Posted On2020-07-28