Mutagenetix > Incidental Mutation

Incidental Mutation 'R8278:Slc6a15'

638076

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8278 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 103394029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

probably null
Transcript: ENSMUST00000074204

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,882,474		probably null	Het
4930562C15Rik	A	T	16: 4,850,176	Q477L	probably benign	Het
Adcy10	A	T	1: 165,503,288	D40V	probably damaging	Het
Cab39l	T	C	14: 59,539,113	Y248H	probably damaging	Het
Casr	G	T	16: 36,515,649	D99E	probably damaging	Het
Cdh16	T	C	8: 104,618,475	E364G	probably benign	Het
Cep104	C	T	4: 153,983,665	T189I	possibly damaging	Het
Chd7	T	A	4: 8,862,485		probably null	Het
Chit1	G	A	1: 134,150,594	R380Q	probably benign	Het
Cpne2	A	G	8: 94,554,688	K174R	probably damaging	Het
Dchs2	T	A	3: 83,271,003	I1121N	probably damaging	Het
Fgf6	A	T	6: 127,015,818	Y78F	probably damaging	Het
H2-T10	A	T	17: 36,118,940	N320K	probably benign	Het
Heatr3	A	T	8: 88,156,733	N398I	possibly damaging	Het
Hrh4	T	C	18: 13,007,227	S60P	probably damaging	Het
Ikbip	A	G	10: 91,096,328	H278R	probably benign	Het
Jmy	A	T	13: 93,464,716	I394N	probably damaging	Het
Klhl8	T	C	5: 103,874,241	E314G	probably benign	Het
Lhx9	A	T	1: 138,838,586	C164S	probably damaging	Het
Loxl3	G	T	6: 83,048,716	G352C	probably damaging	Het
Lrrk1	A	G	7: 66,278,684	F1232S	probably benign	Het
Mpnd	A	G	17: 56,012,469	T311A	probably benign	Het
Mpp7	A	T	18: 7,444,025	D132E	probably benign	Het
Nck2	T	C	1: 43,554,580	S316P	probably damaging	Het
Nckap5	T	C	1: 126,027,772	S348G	probably damaging	Het
Nyap1	C	T	5: 137,731,815	R790H	probably damaging	Het
Olfr1489	C	T	19: 13,633,594	T161I	possibly damaging	Het
Park2	A	T	17: 12,050,722	N421Y	probably benign	Het
Pdcd11	G	A	19: 47,106,297	V507I	probably damaging	Het
Pdzd2	T	C	15: 12,375,909	H1380R	probably benign	Het
Pgap1	C	T	1: 54,490,271	V763I	probably benign	Het
Pnmal2	G	T	7: 16,946,338	V416L	probably damaging	Het
Prpf4	T	C	4: 62,415,256		probably null	Het
Psmb5	C	T	14: 54,617,885	G36D	probably benign	Het
Ptprq	A	G	10: 107,686,378	S571P	possibly damaging	Het
Rap1gap	A	C	4: 137,717,437	S254R	probably damaging	Het
Rufy2	A	T	10: 63,007,693	D492V	probably benign	Het
Ryr2	C	A	13: 11,595,506	E4145*	probably null	Het
Sgsm1	A	G	5: 113,260,092	F898L	probably damaging	Het
Slc26a9	C	A	1: 131,761,776	A487D	possibly damaging	Het
Smad9	A	T	3: 54,789,266	T251S	probably benign	Het
Socs3	A	T	11: 117,967,652	C193*	probably null	Het
Sox6	T	A	7: 115,476,964	D813V	probably damaging	Het
Taf2	A	T	15: 55,065,965	L65*	probably null	Het
Taf6	G	A	5: 138,179,835	A468V	probably benign	Het
Tmem71	T	C	15: 66,555,112	D78G	probably damaging	Het
Tob2	T	C	15: 81,851,087	N227S	probably benign	Het
Trim34a	C	A	7: 104,249,416	Q180K	probably damaging	Het
Ugt1a9	T	C	1: 88,071,656	L276P	possibly damaging	Het
Wdr33	G	A	18: 31,827,352	R23Q	possibly damaging	Het
Wnt7b	T	G	15: 85,543,686	N189H		Het
Zfp609	G	A	9: 65,697,522	A1308V	possibly damaging	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAAGGATTTAAGGGGAGTGAC -3'
(R):5'- GACTTACAACAGAAAGCTGGC -3'

Sequencing Primer
(F):5'- TGACAGAAGATGCATGATATAATCAC -3'
(R):5'- AAACGATGTCTACTTGATCTCTCTG -3'

Posted On

2020-07-28