Incidental Mutation 'R8278:Slc6a15'
ID 638076
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 067701-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 103229890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably null
Transcript: ENSMUST00000074204
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179636
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,668,040 (GRCm39) Q477L probably benign Het
Adcy10 A T 1: 165,330,857 (GRCm39) D40V probably damaging Het
Cab39l T C 14: 59,776,562 (GRCm39) Y248H probably damaging Het
Casr G T 16: 36,336,011 (GRCm39) D99E probably damaging Het
Cdh16 T C 8: 105,345,107 (GRCm39) E364G probably benign Het
Cep104 C T 4: 154,068,122 (GRCm39) T189I possibly damaging Het
Cfap418 T A 4: 10,882,474 (GRCm39) probably null Het
Chd7 T A 4: 8,862,485 (GRCm39) probably null Het
Chit1 G A 1: 134,078,332 (GRCm39) R380Q probably benign Het
Cpne2 A G 8: 95,281,316 (GRCm39) K174R probably damaging Het
Dchs2 T A 3: 83,178,310 (GRCm39) I1121N probably damaging Het
Fgf6 A T 6: 126,992,781 (GRCm39) Y78F probably damaging Het
H2-T10 A T 17: 36,429,832 (GRCm39) N320K probably benign Het
Heatr3 A T 8: 88,883,361 (GRCm39) N398I possibly damaging Het
Hrh4 T C 18: 13,140,284 (GRCm39) S60P probably damaging Het
Ikbip A G 10: 90,932,190 (GRCm39) H278R probably benign Het
Jmy A T 13: 93,601,224 (GRCm39) I394N probably damaging Het
Klhl8 T C 5: 104,022,107 (GRCm39) E314G probably benign Het
Lhx9 A T 1: 138,766,324 (GRCm39) C164S probably damaging Het
Loxl3 G T 6: 83,025,697 (GRCm39) G352C probably damaging Het
Lrrk1 A G 7: 65,928,432 (GRCm39) F1232S probably benign Het
Mpnd A G 17: 56,319,469 (GRCm39) T311A probably benign Het
Mpp7 A T 18: 7,444,025 (GRCm39) D132E probably benign Het
Nck2 T C 1: 43,593,740 (GRCm39) S316P probably damaging Het
Nckap5 T C 1: 125,955,509 (GRCm39) S348G probably damaging Het
Nyap1 C T 5: 137,730,077 (GRCm39) R790H probably damaging Het
Or5b124 C T 19: 13,610,958 (GRCm39) T161I possibly damaging Het
Pdcd11 G A 19: 47,094,736 (GRCm39) V507I probably damaging Het
Pdzd2 T C 15: 12,375,995 (GRCm39) H1380R probably benign Het
Pgap1 C T 1: 54,529,430 (GRCm39) V763I probably benign Het
Pnma8b G T 7: 16,680,263 (GRCm39) V416L probably damaging Het
Prkn A T 17: 12,269,609 (GRCm39) N421Y probably benign Het
Prpf4 T C 4: 62,333,493 (GRCm39) probably null Het
Psmb5 C T 14: 54,855,342 (GRCm39) G36D probably benign Het
Ptprq A G 10: 107,522,239 (GRCm39) S571P possibly damaging Het
Rap1gap A C 4: 137,444,748 (GRCm39) S254R probably damaging Het
Rufy2 A T 10: 62,843,472 (GRCm39) D492V probably benign Het
Ryr2 C A 13: 11,610,392 (GRCm39) E4145* probably null Het
Sgsm1 A G 5: 113,407,958 (GRCm39) F898L probably damaging Het
Slc26a9 C A 1: 131,689,514 (GRCm39) A487D possibly damaging Het
Smad9 A T 3: 54,696,687 (GRCm39) T251S probably benign Het
Socs3 A T 11: 117,858,478 (GRCm39) C193* probably null Het
Sox6 T A 7: 115,076,199 (GRCm39) D813V probably damaging Het
Taf2 A T 15: 54,929,361 (GRCm39) L65* probably null Het
Taf6 G A 5: 138,178,097 (GRCm39) A468V probably benign Het
Tmem71 T C 15: 66,426,961 (GRCm39) D78G probably damaging Het
Tob2 T C 15: 81,735,288 (GRCm39) N227S probably benign Het
Trim34a C A 7: 103,898,623 (GRCm39) Q180K probably damaging Het
Ugt1a9 T C 1: 87,999,378 (GRCm39) L276P possibly damaging Het
Wdr33 G A 18: 31,960,405 (GRCm39) R23Q possibly damaging Het
Wnt7b T G 15: 85,427,887 (GRCm39) N189H Het
Zfp609 G A 9: 65,604,804 (GRCm39) A1308V possibly damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAAGGATTTAAGGGGAGTGAC -3'
(R):5'- GACTTACAACAGAAAGCTGGC -3'

Sequencing Primer
(F):5'- TGACAGAAGATGCATGATATAATCAC -3'
(R):5'- AAACGATGTCTACTTGATCTCTCTG -3'
Posted On 2020-07-28