Incidental Mutation 'R8278:Socs3'
ID638078
Institutional Source Beutler Lab
Gene Symbol Socs3
Ensembl Gene ENSMUSG00000053113
Gene Namesuppressor of cytokine signaling 3
SynonymsCish3, SOCS-3, E2a-Pbx1 target gene in fibroblasts 10, STAT-induced STAT inhibitor 3, CIS3, SSI-3, cytokine-inducible SH2 protein 3, EF-10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location117966079-117970047 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 117967652 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 193 (C193*)
Ref Sequence ENSEMBL: ENSMUSP00000059129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054002]
PDB Structure
solution structure of mouse socs3 in complex with a phosphopeptide from the gp130 receptor [SOLUTION NMR]
Crystal structure of SOCS3 in complex with gp130(pTyr757) phosphopeptide. [X-RAY DIFFRACTION]
SOCS box elonginBC ternary complex [SOLUTION NMR]
Crystal structure of inhibitory protein SOCS3 in complex with JAK2 kinase domain and fragment of GP130 intracellular domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000054002
AA Change: C193*
SMART Domains Protein: ENSMUSP00000059129
Gene: ENSMUSG00000053113
AA Change: C193*

DomainStartEndE-ValueType
SH2 44 133 2.21e-20 SMART
SOCS 180 222 2.66e-14 SMART
SOCS_box 186 221 6.37e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene is induced by various cytokines, including IL6, IL10, and interferon (IFN)-gamma. The protein encoded by this gene can bind to JAK2 kinase, and inhibit the activity of JAK2 kinase. Studies of the mouse counterpart of this gene suggested the roles of this gene in the negative regulation of fetal liver hematopoiesis, and placental development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations cause impairment if gene expression show immunological and hematopoetic abnormalities. Complete gene disruption causes lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Socs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1483:Socs3 UTSW 11 117967568 nonsense probably null
R4846:Socs3 UTSW 11 117967828 missense probably benign
R4998:Socs3 UTSW 11 117967716 missense probably damaging 1.00
R5789:Socs3 UTSW 11 117967782 missense probably benign 0.28
R7174:Socs3 UTSW 11 117967727 nonsense probably null
R7311:Socs3 UTSW 11 117967788 missense probably benign 0.01
R7620:Socs3 UTSW 11 117967570 missense probably damaging 1.00
X0063:Socs3 UTSW 11 117967619 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGGAAGAAGCCAATCTGC -3'
(R):5'- TTCTTTGCCACCCACGGAAC -3'

Sequencing Primer
(F):5'- AGAAGCCAATCTGCCCCTGG -3'
(R):5'- GAACCCTCGTCCGAAGTTC -3'
Posted On2020-07-28