Mutagenetix > Incidental Mutation

Incidental Mutation 'R8278:Taf2'

638084

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8278 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 55065965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 65 (L65*)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000041733
AA Change: L65*

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: L65*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,882,474		probably null	Het
4930562C15Rik	A	T	16: 4,850,176	Q477L	probably benign	Het
Adcy10	A	T	1: 165,503,288	D40V	probably damaging	Het
Cab39l	T	C	14: 59,539,113	Y248H	probably damaging	Het
Casr	G	T	16: 36,515,649	D99E	probably damaging	Het
Cdh16	T	C	8: 104,618,475	E364G	probably benign	Het
Cep104	C	T	4: 153,983,665	T189I	possibly damaging	Het
Chd7	T	A	4: 8,862,485		probably null	Het
Chit1	G	A	1: 134,150,594	R380Q	probably benign	Het
Cpne2	A	G	8: 94,554,688	K174R	probably damaging	Het
Dchs2	T	A	3: 83,271,003	I1121N	probably damaging	Het
Fgf6	A	T	6: 127,015,818	Y78F	probably damaging	Het
H2-T10	A	T	17: 36,118,940	N320K	probably benign	Het
Heatr3	A	T	8: 88,156,733	N398I	possibly damaging	Het
Hrh4	T	C	18: 13,007,227	S60P	probably damaging	Het
Ikbip	A	G	10: 91,096,328	H278R	probably benign	Het
Jmy	A	T	13: 93,464,716	I394N	probably damaging	Het
Klhl8	T	C	5: 103,874,241	E314G	probably benign	Het
Lhx9	A	T	1: 138,838,586	C164S	probably damaging	Het
Loxl3	G	T	6: 83,048,716	G352C	probably damaging	Het
Lrrk1	A	G	7: 66,278,684	F1232S	probably benign	Het
Mpnd	A	G	17: 56,012,469	T311A	probably benign	Het
Mpp7	A	T	18: 7,444,025	D132E	probably benign	Het
Nck2	T	C	1: 43,554,580	S316P	probably damaging	Het
Nckap5	T	C	1: 126,027,772	S348G	probably damaging	Het
Nyap1	C	T	5: 137,731,815	R790H	probably damaging	Het
Olfr1489	C	T	19: 13,633,594	T161I	possibly damaging	Het
Park2	A	T	17: 12,050,722	N421Y	probably benign	Het
Pdcd11	G	A	19: 47,106,297	V507I	probably damaging	Het
Pdzd2	T	C	15: 12,375,909	H1380R	probably benign	Het
Pgap1	C	T	1: 54,490,271	V763I	probably benign	Het
Pnmal2	G	T	7: 16,946,338	V416L	probably damaging	Het
Prpf4	T	C	4: 62,415,256		probably null	Het
Psmb5	C	T	14: 54,617,885	G36D	probably benign	Het
Ptprq	A	G	10: 107,686,378	S571P	possibly damaging	Het
Rap1gap	A	C	4: 137,717,437	S254R	probably damaging	Het
Rufy2	A	T	10: 63,007,693	D492V	probably benign	Het
Ryr2	C	A	13: 11,595,506	E4145*	probably null	Het
Sgsm1	A	G	5: 113,260,092	F898L	probably damaging	Het
Slc26a9	C	A	1: 131,761,776	A487D	possibly damaging	Het
Slc6a15	T	C	10: 103,394,029		probably null	Het
Smad9	A	T	3: 54,789,266	T251S	probably benign	Het
Socs3	A	T	11: 117,967,652	C193*	probably null	Het
Sox6	T	A	7: 115,476,964	D813V	probably damaging	Het
Taf6	G	A	5: 138,179,835	A468V	probably benign	Het
Tmem71	T	C	15: 66,555,112	D78G	probably damaging	Het
Tob2	T	C	15: 81,851,087	N227S	probably benign	Het
Trim34a	C	A	7: 104,249,416	Q180K	probably damaging	Het
Ugt1a9	T	C	1: 88,071,656	L276P	possibly damaging	Het
Wdr33	G	A	18: 31,827,352	R23Q	possibly damaging	Het
Wnt7b	T	G	15: 85,543,686	N189H		Het
Zfp609	G	A	9: 65,697,522	A1308V	possibly damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATTTGCAGGGCAGTAAAAGC -3'
(R):5'- ACTCACGTGTACATTGGGAC -3'

Sequencing Primer
(F):5'- GGGAAAGTTTGTTGAAAAACAATCTC -3'
(R):5'- ACATTGGGACTTTCCTTTCAGAG -3'

Posted On

2020-07-28