Incidental Mutation 'R8278:Tmem71'
ID 638085
Institutional Source Beutler Lab
Gene Symbol Tmem71
Ensembl Gene ENSMUSG00000036944
Gene Name transmembrane protein 71
Synonyms
MMRRC Submission 067701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 66398061-66432952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66426961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 78 (D78G)
Ref Sequence ENSEMBL: ENSMUSP00000044493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048372]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048372
AA Change: D78G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044493
Gene: ENSMUSG00000036944
AA Change: D78G

DomainStartEndE-ValueType
Pfam:TMEM71 1 152 1.9e-85 PFAM
low complexity region 153 165 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,668,040 (GRCm39) Q477L probably benign Het
Adcy10 A T 1: 165,330,857 (GRCm39) D40V probably damaging Het
Cab39l T C 14: 59,776,562 (GRCm39) Y248H probably damaging Het
Casr G T 16: 36,336,011 (GRCm39) D99E probably damaging Het
Cdh16 T C 8: 105,345,107 (GRCm39) E364G probably benign Het
Cep104 C T 4: 154,068,122 (GRCm39) T189I possibly damaging Het
Cfap418 T A 4: 10,882,474 (GRCm39) probably null Het
Chd7 T A 4: 8,862,485 (GRCm39) probably null Het
Chit1 G A 1: 134,078,332 (GRCm39) R380Q probably benign Het
Cpne2 A G 8: 95,281,316 (GRCm39) K174R probably damaging Het
Dchs2 T A 3: 83,178,310 (GRCm39) I1121N probably damaging Het
Fgf6 A T 6: 126,992,781 (GRCm39) Y78F probably damaging Het
H2-T10 A T 17: 36,429,832 (GRCm39) N320K probably benign Het
Heatr3 A T 8: 88,883,361 (GRCm39) N398I possibly damaging Het
Hrh4 T C 18: 13,140,284 (GRCm39) S60P probably damaging Het
Ikbip A G 10: 90,932,190 (GRCm39) H278R probably benign Het
Jmy A T 13: 93,601,224 (GRCm39) I394N probably damaging Het
Klhl8 T C 5: 104,022,107 (GRCm39) E314G probably benign Het
Lhx9 A T 1: 138,766,324 (GRCm39) C164S probably damaging Het
Loxl3 G T 6: 83,025,697 (GRCm39) G352C probably damaging Het
Lrrk1 A G 7: 65,928,432 (GRCm39) F1232S probably benign Het
Mpnd A G 17: 56,319,469 (GRCm39) T311A probably benign Het
Mpp7 A T 18: 7,444,025 (GRCm39) D132E probably benign Het
Nck2 T C 1: 43,593,740 (GRCm39) S316P probably damaging Het
Nckap5 T C 1: 125,955,509 (GRCm39) S348G probably damaging Het
Nyap1 C T 5: 137,730,077 (GRCm39) R790H probably damaging Het
Or5b124 C T 19: 13,610,958 (GRCm39) T161I possibly damaging Het
Pdcd11 G A 19: 47,094,736 (GRCm39) V507I probably damaging Het
Pdzd2 T C 15: 12,375,995 (GRCm39) H1380R probably benign Het
Pgap1 C T 1: 54,529,430 (GRCm39) V763I probably benign Het
Pnma8b G T 7: 16,680,263 (GRCm39) V416L probably damaging Het
Prkn A T 17: 12,269,609 (GRCm39) N421Y probably benign Het
Prpf4 T C 4: 62,333,493 (GRCm39) probably null Het
Psmb5 C T 14: 54,855,342 (GRCm39) G36D probably benign Het
Ptprq A G 10: 107,522,239 (GRCm39) S571P possibly damaging Het
Rap1gap A C 4: 137,444,748 (GRCm39) S254R probably damaging Het
Rufy2 A T 10: 62,843,472 (GRCm39) D492V probably benign Het
Ryr2 C A 13: 11,610,392 (GRCm39) E4145* probably null Het
Sgsm1 A G 5: 113,407,958 (GRCm39) F898L probably damaging Het
Slc26a9 C A 1: 131,689,514 (GRCm39) A487D possibly damaging Het
Slc6a15 T C 10: 103,229,890 (GRCm39) probably null Het
Smad9 A T 3: 54,696,687 (GRCm39) T251S probably benign Het
Socs3 A T 11: 117,858,478 (GRCm39) C193* probably null Het
Sox6 T A 7: 115,076,199 (GRCm39) D813V probably damaging Het
Taf2 A T 15: 54,929,361 (GRCm39) L65* probably null Het
Taf6 G A 5: 138,178,097 (GRCm39) A468V probably benign Het
Tob2 T C 15: 81,735,288 (GRCm39) N227S probably benign Het
Trim34a C A 7: 103,898,623 (GRCm39) Q180K probably damaging Het
Ugt1a9 T C 1: 87,999,378 (GRCm39) L276P possibly damaging Het
Wdr33 G A 18: 31,960,405 (GRCm39) R23Q possibly damaging Het
Wnt7b T G 15: 85,427,887 (GRCm39) N189H Het
Zfp609 G A 9: 65,604,804 (GRCm39) A1308V possibly damaging Het
Other mutations in Tmem71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Tmem71 APN 15 66,426,874 (GRCm39) splice site probably benign
IGL02517:Tmem71 APN 15 66,413,466 (GRCm39) missense probably benign
R1766:Tmem71 UTSW 15 66,413,548 (GRCm39) missense probably benign 0.00
R2321:Tmem71 UTSW 15 66,423,849 (GRCm39) missense possibly damaging 0.73
R4965:Tmem71 UTSW 15 66,410,710 (GRCm39) missense probably benign
R5180:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R5181:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R5324:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R5736:Tmem71 UTSW 15 66,404,496 (GRCm39) missense probably benign 0.04
R6684:Tmem71 UTSW 15 66,413,539 (GRCm39) missense possibly damaging 0.74
R8443:Tmem71 UTSW 15 66,413,421 (GRCm39) critical splice donor site probably null
R8808:Tmem71 UTSW 15 66,410,655 (GRCm39) missense possibly damaging 0.87
R8906:Tmem71 UTSW 15 66,404,606 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCATACTCTTGAGCAGCAGTG -3'
(R):5'- TCTTTCACAGTGACTACATGGTC -3'

Sequencing Primer
(F):5'- CAGTGAGCTGCTTGTGCC -3'
(R):5'- TCACAGTGACTACATGGTCATATGGG -3'
Posted On 2020-07-28