Incidental Mutation 'R8278:Wnt7b'
ID638087
Institutional Source Beutler Lab
Gene Symbol Wnt7b
Ensembl Gene ENSMUSG00000022382
Gene Namewingless-type MMTV integration site family, member 7B
SynonymsWnt-7b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85535437-85582473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85543686 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 189 (N189H)
Ref Sequence ENSEMBL: ENSMUSP00000105051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023015] [ENSMUST00000109424] [ENSMUST00000167968]
Predicted Effect
SMART Domains Protein: ENSMUSP00000023015
Gene: ENSMUSG00000022382
AA Change: N185H

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
WNT1 40 349 1.29e-214 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000105051
Gene: ENSMUSG00000022382
AA Change: N189H

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
WNT1 44 353 1.29e-214 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167968
AA Change: N118H

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130627
Gene: ENSMUSG00000022382
AA Change: N118H

DomainStartEndE-ValueType
WNT1 1 282 1.21e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null embryos die at midgestational stages due to placental abnormalities involving the fusion of the chorion and allantois. Mice homozygous for a truncated allele display neonatal lethality, respiratory failure, and lung hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Wnt7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02543:Wnt7b APN 15 85558896 splice site probably benign
R0243:Wnt7b UTSW 15 85558902 critical splice donor site probably null
R0735:Wnt7b UTSW 15 85537495 missense probably damaging 1.00
R0835:Wnt7b UTSW 15 85537777 missense probably damaging 1.00
R1917:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R1919:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R3914:Wnt7b UTSW 15 85537858 missense possibly damaging 0.90
R5893:Wnt7b UTSW 15 85581374 intron probably benign
R7483:Wnt7b UTSW 15 85537414 missense possibly damaging 0.95
R7498:Wnt7b UTSW 15 85543679 missense probably damaging 1.00
R7787:Wnt7b UTSW 15 85543911 missense probably damaging 0.99
R8079:Wnt7b UTSW 15 85537445 missense probably damaging 1.00
Z1177:Wnt7b UTSW 15 85559069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGAGGTGTCAGGCCTG -3'
(R):5'- CTGAGCAATTGTGGCTGTGAC -3'

Sequencing Primer
(F):5'- TGTCAGGCCTGCACAAAG -3'
(R):5'- GCTGTGACCGGGAGAAGC -3'
Posted On2020-07-28