Mutagenetix > Incidental Mutations

Incidental Mutation 'R0724:Corin'

63809

Institutional Source

Beutler Lab

Gene Symbol

Corin

Ensembl Gene

ENSMUSG00000005220

Gene Name

corin

Synonyms

Lrp4

MMRRC Submission

038906-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R0724 (G1)

Quality Score

109

Status

Validated

Chromosome

Chromosomal Location

72300025-72504473 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 72332795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]

AlphaFold

Q9Z319

Predicted Effect

probably benign
Transcript: ENSMUST00000005352

SMART Domains

Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
FRI	205	318	6.15e-11	SMART
LDLa	336	372	1.31e-8	SMART
LDLa	373	408	1.5e-8	SMART
LDLa	409	447	5.47e-11	SMART
LDLa	448	484	1.22e-8	SMART
low complexity region	508	521	N/A	INTRINSIC
FRI	522	643	2.75e-31	SMART
LDLa	647	684	2.19e-10	SMART
LDLa	685	722	1.76e-5	SMART
LDLa	723	759	4.18e-7	SMART
SR	758	853	3.99e-10	SMART
Tryp_SPc	868	1097	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167460

SMART Domains

Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	342	1.5e-8	SMART
LDLa	343	381	5.47e-11	SMART
LDLa	382	418	1.22e-8	SMART
low complexity region	442	455	N/A	INTRINSIC
FRI	456	577	2.75e-31	SMART
LDLa	581	618	2.19e-10	SMART
LDLa	619	656	1.76e-5	SMART
LDLa	657	693	4.18e-7	SMART
SR	692	787	3.99e-10	SMART
Tryp_SPc	802	1031	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175766

SMART Domains

Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	45	67	N/A	INTRINSIC
FRI	137	250	6.15e-11	SMART
LDLa	268	304	1.31e-8	SMART
LDLa	305	343	2.07e-11	SMART
low complexity region	367	380	N/A	INTRINSIC
FRI	381	502	2.75e-31	SMART
LDLa	506	543	2.19e-10	SMART
LDLa	544	581	1.76e-5	SMART
LDLa	582	618	4.18e-7	SMART
SR	617	712	3.99e-10	SMART
Tryp_SPc	727	956	5.45e-76	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176396

Predicted Effect

probably benign
Transcript: ENSMUST00000176974

SMART Domains

Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	344	3.86e-11	SMART
LDLa	345	381	1.22e-8	SMART
low complexity region	405	418	N/A	INTRINSIC
FRI	419	540	2.75e-31	SMART
LDLa	544	581	2.19e-10	SMART
LDLa	582	619	1.76e-5	SMART
LDLa	620	656	4.18e-7	SMART
SR	655	750	3.99e-10	SMART
Tryp_SPc	765	994	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177290

SMART Domains

Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	72	185	6.15e-11	SMART
LDLa	203	239	1.31e-8	SMART
LDLa	240	275	1.5e-8	SMART
LDLa	276	314	5.47e-11	SMART
LDLa	315	351	1.22e-8	SMART
low complexity region	375	388	N/A	INTRINSIC
FRI	389	510	2.75e-31	SMART
LDLa	514	551	2.19e-10	SMART
LDLa	552	589	1.76e-5	SMART
LDLa	590	626	4.18e-7	SMART
SR	625	720	3.99e-10	SMART
Tryp_SPc	735	964	5.45e-76	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Corin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Corin	APN	5	72304888	missense	probably damaging	1.00
IGL01114:Corin	APN	5	72305011	missense	probably damaging	1.00
IGL01351:Corin	APN	5	72338991	missense	probably damaging	1.00
IGL01516:Corin	APN	5	72454487	nonsense	probably null
IGL01785:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01786:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01845:Corin	APN	5	72353939	missense	probably damaging	1.00
IGL02097:Corin	APN	5	72372146	missense	probably damaging	1.00
IGL02629:Corin	APN	5	72332673	missense	probably damaging	1.00
IGL03085:Corin	APN	5	72353930	missense	probably damaging	1.00
IGL03120:Corin	APN	5	72360689	missense	probably damaging	1.00
IGL03150:Corin	APN	5	72302858	missense	probably damaging	1.00
IGL03183:Corin	APN	5	72301586	missense	probably damaging	0.99
IGL03185:Corin	APN	5	72332781	missense	probably damaging	1.00
IGL03408:Corin	APN	5	72342961	missense	probably benign	0.40
alpaca	UTSW	5	72503952	missense	possibly damaging	0.85
R0078:Corin	UTSW	5	72454473	missense	possibly damaging	0.77
R1065:Corin	UTSW	5	72301650	nonsense	probably null
R1301:Corin	UTSW	5	72304933	missense	possibly damaging	0.81
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1520:Corin	UTSW	5	72330895	missense	probably damaging	1.00
R1584:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1617:Corin	UTSW	5	72503952	missense	possibly damaging	0.85
R1912:Corin	UTSW	5	72358403	missense	probably damaging	1.00
R2059:Corin	UTSW	5	72316051	missense	possibly damaging	0.76
R2173:Corin	UTSW	5	72504079	missense	probably benign	0.01
R2242:Corin	UTSW	5	72332711	missense	probably damaging	1.00
R2373:Corin	UTSW	5	72339038	missense	probably damaging	1.00
R2850:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R3683:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3684:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3790:Corin	UTSW	5	72435298	missense	probably benign	0.38
R3847:Corin	UTSW	5	72422165	missense	probably benign	0.13
R3926:Corin	UTSW	5	72372130	missense	probably damaging	1.00
R3939:Corin	UTSW	5	72339879	missense	possibly damaging	0.80
R3945:Corin	UTSW	5	72358424	missense	probably damaging	1.00
R4079:Corin	UTSW	5	72503883	missense	probably benign	0.03
R4224:Corin	UTSW	5	72343108	missense	probably damaging	1.00
R4473:Corin	UTSW	5	72339057	missense	probably damaging	1.00
R4585:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4586:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4849:Corin	UTSW	5	72302835	missense	probably damaging	1.00
R4926:Corin	UTSW	5	72372182	missense	probably damaging	1.00
R5080:Corin	UTSW	5	72353851	intron	probably benign
R5138:Corin	UTSW	5	72339059	missense	probably damaging	1.00
R5262:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R5268:Corin	UTSW	5	72343019	missense	probably damaging	1.00
R5302:Corin	UTSW	5	72316098	missense	probably benign	0.07
R5307:Corin	UTSW	5	72356978	missense	probably damaging	1.00
R5324:Corin	UTSW	5	72435257	missense	probably damaging	1.00
R5352:Corin	UTSW	5	72305033	missense	probably benign	0.04
R5373:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5374:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5484:Corin	UTSW	5	72358484	missense	probably benign	0.15
R5502:Corin	UTSW	5	72316106	nonsense	probably null
R5544:Corin	UTSW	5	72305014	nonsense	probably null
R5682:Corin	UTSW	5	72422154	missense	possibly damaging	0.85
R5818:Corin	UTSW	5	72435395	missense	probably benign	0.00
R5992:Corin	UTSW	5	72316389	missense	probably benign	0.01
R6115:Corin	UTSW	5	72360729	missense	probably damaging	1.00
R6181:Corin	UTSW	5	72372096	critical splice donor site	probably null
R6317:Corin	UTSW	5	72339045	missense	probably damaging	1.00
R7053:Corin	UTSW	5	72301527	missense	probably benign	0.28
R7242:Corin	UTSW	5	72305055	missense	probably benign	0.14
R7452:Corin	UTSW	5	72435247	missense	possibly damaging	0.94
R7783:Corin	UTSW	5	72301624	missense	probably benign	0.26
R7903:Corin	UTSW	5	72301500	missense	probably benign	0.00
R7956:Corin	UTSW	5	72422187	missense	probably damaging	0.99
R8007:Corin	UTSW	5	72316103	missense	probably damaging	0.96
R8125:Corin	UTSW	5	72358463	missense	probably damaging	0.96
R8215:Corin	UTSW	5	72305018	missense	probably damaging	1.00
R8251:Corin	UTSW	5	72356926	missense	probably damaging	1.00
R8364:Corin	UTSW	5	72304931	missense	probably benign
R8505:Corin	UTSW	5	72435407	missense	probably benign	0.21
R8746:Corin	UTSW	5	72435352	missense	probably benign	0.31
R8887:Corin	UTSW	5	72329610	critical splice donor site	probably null
Z1177:Corin	UTSW	5	72454493	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGAACCCAGATCAAATAACTCAGGAGTG -3'
(R):5'- CAGAATGGAGACTGCCGTGAGC -3'

Sequencing Primer
(F):5'- CATTTTGGATACTAGCATGAGGTC -3'
(R):5'- GCTCCTACTTTCAGAATCACACG -3'

Posted On

2013-07-30