Incidental Mutation 'R8278:Park2'
ID638090
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene NameParkinson disease (autosomal recessive, juvenile) 2, parkin
SynonymsPRKN
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location10840384-12063361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12050722 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 421 (N421Y)
Ref Sequence ENSEMBL: ENSMUSP00000140587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191124]
PDB Structure
NMR structure of ubiquitin-like domain in murine Parkin [SOLUTION NMR]
Crystal structure of ubiquitin-like domain of murine Parkin [X-RAY DIFFRACTION]
Crystal Structure of parkin ubiquitin-like domain R33Q mutant [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000191124
AA Change: N421Y

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826
AA Change: N421Y

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4710:Park2 UTSW 17 11854833 missense possibly damaging 0.89
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6360:Park2 UTSW 17 12004052 missense probably damaging 1.00
R6698:Park2 UTSW 17 11067296 splice site probably null
R7163:Park2 UTSW 17 12061547 missense probably damaging 1.00
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
R8299:Park2 UTSW 17 11237521 missense probably benign 0.25
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACGTTCATTTCTGAGAAGTGTC -3'
(R):5'- ACCAGGTTAGTTTGAGCGGG -3'

Sequencing Primer
(F):5'- GTTCATTTCTGAGAAGTGTCTTCAC -3'
(R):5'- GGGTTCAGGAGGTTGAGAC -3'
Posted On2020-07-28