Mutagenetix > Incidental Mutation

Incidental Mutation 'R8278:Mpp7'

638093

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R8278 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 7444025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 132 (D132E)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115869
AA Change: D132E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: D132E

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,882,474		probably null	Het
4930562C15Rik	A	T	16: 4,850,176	Q477L	probably benign	Het
Adcy10	A	T	1: 165,503,288	D40V	probably damaging	Het
Cab39l	T	C	14: 59,539,113	Y248H	probably damaging	Het
Casr	G	T	16: 36,515,649	D99E	probably damaging	Het
Cdh16	T	C	8: 104,618,475	E364G	probably benign	Het
Cep104	C	T	4: 153,983,665	T189I	possibly damaging	Het
Chd7	T	A	4: 8,862,485		probably null	Het
Chit1	G	A	1: 134,150,594	R380Q	probably benign	Het
Cpne2	A	G	8: 94,554,688	K174R	probably damaging	Het
Dchs2	T	A	3: 83,271,003	I1121N	probably damaging	Het
Fgf6	A	T	6: 127,015,818	Y78F	probably damaging	Het
H2-T10	A	T	17: 36,118,940	N320K	probably benign	Het
Heatr3	A	T	8: 88,156,733	N398I	possibly damaging	Het
Hrh4	T	C	18: 13,007,227	S60P	probably damaging	Het
Ikbip	A	G	10: 91,096,328	H278R	probably benign	Het
Jmy	A	T	13: 93,464,716	I394N	probably damaging	Het
Klhl8	T	C	5: 103,874,241	E314G	probably benign	Het
Lhx9	A	T	1: 138,838,586	C164S	probably damaging	Het
Loxl3	G	T	6: 83,048,716	G352C	probably damaging	Het
Lrrk1	A	G	7: 66,278,684	F1232S	probably benign	Het
Mpnd	A	G	17: 56,012,469	T311A	probably benign	Het
Nck2	T	C	1: 43,554,580	S316P	probably damaging	Het
Nckap5	T	C	1: 126,027,772	S348G	probably damaging	Het
Nyap1	C	T	5: 137,731,815	R790H	probably damaging	Het
Olfr1489	C	T	19: 13,633,594	T161I	possibly damaging	Het
Park2	A	T	17: 12,050,722	N421Y	probably benign	Het
Pdcd11	G	A	19: 47,106,297	V507I	probably damaging	Het
Pdzd2	T	C	15: 12,375,909	H1380R	probably benign	Het
Pgap1	C	T	1: 54,490,271	V763I	probably benign	Het
Pnmal2	G	T	7: 16,946,338	V416L	probably damaging	Het
Prpf4	T	C	4: 62,415,256		probably null	Het
Psmb5	C	T	14: 54,617,885	G36D	probably benign	Het
Ptprq	A	G	10: 107,686,378	S571P	possibly damaging	Het
Rap1gap	A	C	4: 137,717,437	S254R	probably damaging	Het
Rufy2	A	T	10: 63,007,693	D492V	probably benign	Het
Ryr2	C	A	13: 11,595,506	E4145*	probably null	Het
Sgsm1	A	G	5: 113,260,092	F898L	probably damaging	Het
Slc26a9	C	A	1: 131,761,776	A487D	possibly damaging	Het
Slc6a15	T	C	10: 103,394,029		probably null	Het
Smad9	A	T	3: 54,789,266	T251S	probably benign	Het
Socs3	A	T	11: 117,967,652	C193*	probably null	Het
Sox6	T	A	7: 115,476,964	D813V	probably damaging	Het
Taf2	A	T	15: 55,065,965	L65*	probably null	Het
Taf6	G	A	5: 138,179,835	A468V	probably benign	Het
Tmem71	T	C	15: 66,555,112	D78G	probably damaging	Het
Tob2	T	C	15: 81,851,087	N227S	probably benign	Het
Trim34a	C	A	7: 104,249,416	Q180K	probably damaging	Het
Ugt1a9	T	C	1: 88,071,656	L276P	possibly damaging	Het
Wdr33	G	A	18: 31,827,352	R23Q	possibly damaging	Het
Wnt7b	T	G	15: 85,543,686	N189H		Het
Zfp609	G	A	9: 65,697,522	A1308V	possibly damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCATCTCCTTTGGATGAAGATGTC -3'
(R):5'- GAAGACACCCTGCTTCAAATGG -3'

Sequencing Primer
(F):5'- CTTATTTATCTTTACGGTGTAGGGGC -3'
(R):5'- GACACCCTGCTTCAAATGGTTTCC -3'

Posted On

2020-07-28