Incidental Mutation 'R8278:Wdr33'
ID638095
Institutional Source Beutler Lab
Gene Symbol Wdr33
Ensembl Gene ENSMUSG00000024400
Gene NameWD repeat domain 33
Synonyms2810021O11Rik, 1110001N06Rik, 8430413N20Rik, 2310011G05Rik, WDC146
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31804057-31908987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31827352 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 23 (R23Q)
Ref Sequence ENSEMBL: ENSMUSP00000080936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025264] [ENSMUST00000082319]
Predicted Effect probably benign
Transcript: ENSMUST00000025264
AA Change: R23Q

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025264
Gene: ENSMUSG00000024400
AA Change: R23Q

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
WD40 233 274 2.59e-7 SMART
WD40 277 316 2.73e-6 SMART
WD40 320 360 1.71e-7 SMART
WD40 364 403 1.52e-4 SMART
low complexity region 481 499 N/A INTRINSIC
coiled coil region 531 559 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 608 624 N/A INTRINSIC
low complexity region 628 668 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 725 761 N/A INTRINSIC
internal_repeat_1 778 803 3.47e-9 PROSPERO
low complexity region 806 818 N/A INTRINSIC
internal_repeat_1 821 845 3.47e-9 PROSPERO
low complexity region 848 881 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 938 951 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1041 1049 N/A INTRINSIC
low complexity region 1057 1100 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1190 1207 N/A INTRINSIC
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1287 1330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000082319
AA Change: R23Q

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080936
Gene: ENSMUSG00000024400
AA Change: R23Q

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Wdr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr33 APN 18 31878116 missense probably damaging 1.00
IGL01099:Wdr33 APN 18 31906789 unclassified probably benign
IGL01628:Wdr33 APN 18 31888310 missense unknown
IGL03296:Wdr33 APN 18 31827391 missense probably benign 0.03
R0103:Wdr33 UTSW 18 31833335 missense probably damaging 1.00
R0279:Wdr33 UTSW 18 31888324 missense unknown
R0563:Wdr33 UTSW 18 31886739 missense possibly damaging 0.94
R0730:Wdr33 UTSW 18 31835376 splice site probably benign
R1077:Wdr33 UTSW 18 31835461 missense probably benign 0.03
R1377:Wdr33 UTSW 18 31888641 missense unknown
R1712:Wdr33 UTSW 18 31896631 missense unknown
R1855:Wdr33 UTSW 18 31906856 unclassified probably benign
R2013:Wdr33 UTSW 18 31888976 missense unknown
R2014:Wdr33 UTSW 18 31833599 missense probably damaging 1.00
R4497:Wdr33 UTSW 18 31893079 missense unknown
R4727:Wdr33 UTSW 18 31888447 missense unknown
R4739:Wdr33 UTSW 18 31886086 missense probably benign 0.17
R4777:Wdr33 UTSW 18 31881248 missense probably damaging 1.00
R4907:Wdr33 UTSW 18 31906993 makesense probably null
R5811:Wdr33 UTSW 18 31902620 missense unknown
R6053:Wdr33 UTSW 18 31878063 missense possibly damaging 0.93
R6454:Wdr33 UTSW 18 31829975 missense possibly damaging 0.47
R7112:Wdr33 UTSW 18 31893003 missense unknown
R7369:Wdr33 UTSW 18 31886666 missense probably benign 0.00
R7519:Wdr33 UTSW 18 31896770 missense unknown
RF014:Wdr33 UTSW 18 31881273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGATGTTTTCAGGTTAGAAAATG -3'
(R):5'- TCAACATGCTAATCCATCCCACTAAT -3'

Sequencing Primer
(F):5'- GTTTTCTAGCCATAGTTGTCAAGTC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2020-07-28