Incidental Mutation 'R8278:Olfr1489'
ID638096
Institutional Source Beutler Lab
Gene Symbol Olfr1489
Ensembl Gene ENSMUSG00000045678
Gene Nameolfactory receptor 1489
SynonymsGA_x6K02T2RE5P-3965668-3966609, MOR202-19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13631621-13643987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13633594 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 161 (T161I)
Ref Sequence ENSEMBL: ENSMUSP00000062444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053113
AA Change: T161I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062444
Gene: ENSMUSG00000045678
AA Change: T161I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-53 PFAM
Pfam:7tm_1 39 289 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Olfr1489
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Olfr1489 APN 19 13633539 missense probably benign 0.25
IGL03052:Olfr1489 UTSW 19 13633726 missense probably benign 0.00
R0179:Olfr1489 UTSW 19 13633140 missense probably damaging 1.00
R0270:Olfr1489 UTSW 19 13633684 missense probably damaging 1.00
R0633:Olfr1489 UTSW 19 13633336 missense probably damaging 0.99
R4466:Olfr1489 UTSW 19 13633437 missense probably damaging 0.97
R4884:Olfr1489 UTSW 19 13634027 missense probably benign 0.14
R5247:Olfr1489 UTSW 19 13633414 missense probably damaging 1.00
R5332:Olfr1489 UTSW 19 13633365 missense possibly damaging 0.91
R5754:Olfr1489 UTSW 19 13633993 missense probably damaging 0.99
R6165:Olfr1489 UTSW 19 13633143 missense possibly damaging 0.93
R6165:Olfr1489 UTSW 19 13633588 missense probably benign 0.02
R6221:Olfr1489 UTSW 19 13633466 nonsense probably null
R6486:Olfr1489 UTSW 19 13633691 missense probably damaging 1.00
R7008:Olfr1489 UTSW 19 13633621 missense probably damaging 1.00
R7076:Olfr1489 UTSW 19 13633880 missense possibly damaging 0.95
R7539:Olfr1489 UTSW 19 13633569 nonsense probably null
Z1088:Olfr1489 UTSW 19 13633453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGCTACACAGATGTTCTTC -3'
(R):5'- GAACGCATCCTCAAGATTGC -3'

Sequencing Primer
(F):5'- CGCTACACAGATGTTCTTCTTAATAG -3'
(R):5'- ATCCTCAAGATTGCAACAAAAATAAG -3'
Posted On2020-07-28