Mutagenetix > Incidental Mutations

Incidental Mutation 'R0724:Enam'

63810

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

038906-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R0724 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88487975-88506049 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88501994 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 454 (Y454C)

Ref Sequence

ENSEMBL: ENSMUSP00000142854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031222
AA Change: Y379C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: Y379C

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199104
AA Change: Y454C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: Y454C

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Meta Mutation Damage Score

0.2352

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88501484	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88503749	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88503674	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88504559	nonsense	probably null
IGL02371:Enam	APN	5	88502809	missense	probably benign	0.39
IGL02596:Enam	APN	5	88503026	missense	probably benign	0.01
IGL03026:Enam	APN	5	88503299	missense	probably benign	0.38
IGL03303:Enam	APN	5	88504591	missense	probably benign	0.12
opinionated	UTSW	5	88503026	missense	probably benign	0.04
recalcitrant	UTSW	5	88503791	nonsense	probably null
R0200:Enam	UTSW	5	88493027	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88489655	splice site	probably benign
R0395:Enam	UTSW	5	88501508	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88503105	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88493027	missense	possibly damaging	0.96
R0927:Enam	UTSW	5	88494060	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88501967	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88504019	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88503258	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88494068	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88494068	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88503227	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88504465	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88504622	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88501787	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88492920	missense	probably benign	0.02
R2196:Enam	UTSW	5	88502744	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88503149	missense	probably benign	0.24
R2497:Enam	UTSW	5	88502694	missense	probably benign	0.13
R3615:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88502815	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88503377	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88503548	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88504283	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88492968	missense	probably benign	0.02
R4702:Enam	UTSW	5	88503791	nonsense	probably null
R4703:Enam	UTSW	5	88503791	nonsense	probably null
R4704:Enam	UTSW	5	88503791	nonsense	probably null
R4705:Enam	UTSW	5	88503791	nonsense	probably null
R4714:Enam	UTSW	5	88503536	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88501543	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88493108	nonsense	probably null
R4840:Enam	UTSW	5	88503026	missense	probably benign	0.04
R4856:Enam	UTSW	5	88488734	nonsense	probably null
R4886:Enam	UTSW	5	88488734	nonsense	probably null
R4910:Enam	UTSW	5	88502314	missense	probably benign
R4911:Enam	UTSW	5	88502314	missense	probably benign
R6103:Enam	UTSW	5	88502328	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88502917	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88501691	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88502327	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88501488	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88501664	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88501820	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88503025	missense	probably benign	0.00
R7648:Enam	UTSW	5	88504157	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88503971	missense	possibly damaging	0.80
X0018:Enam	UTSW	5	88502691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCGGAAATGACACTAGCCCAATAGG -3'
(R):5'- TTGTTTGAGGCCGGATTAGCTCCC -3'

Sequencing Primer
(F):5'- ACAGTTCAAAACGGTGTCTTCC -3'
(R):5'- CTCCCACAAAGGGTTTGTTTGAG -3'

Posted On

2013-07-30