Incidental Mutation 'R0724:Enam'
ID 63810
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Name enamelin
Synonyms abte
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R0724 (G1)
Quality Score 83
Status Validated
Chromosome 5
Chromosomal Location 88635834-88653908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88649853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 454 (Y454C)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
AlphaFold O55196
Predicted Effect probably damaging
Transcript: ENSMUST00000031222
AA Change: Y379C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: Y379C

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199104
AA Change: Y454C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: Y454C

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.2352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,573 (GRCm39) E136G probably benign Het
Adgre4 T A 17: 56,159,281 (GRCm39) S655R probably benign Het
Ak7 T A 12: 105,676,513 (GRCm39) V71E probably benign Het
Ank2 C T 3: 126,755,986 (GRCm39) R1077H probably damaging Het
Anxa3 A G 5: 96,976,607 (GRCm39) T198A possibly damaging Het
Atp1a1 A T 3: 101,499,755 (GRCm39) I109N possibly damaging Het
Camta1 A G 4: 151,162,349 (GRCm39) I119T probably damaging Het
Carm1 A G 9: 21,498,670 (GRCm39) Y504C probably damaging Het
Casp1 C T 9: 5,303,077 (GRCm39) P177L probably benign Het
Ccdc122 C A 14: 77,329,517 (GRCm39) probably benign Het
Ces1a A G 8: 93,766,141 (GRCm39) S158P probably damaging Het
Ces3a T A 8: 105,776,827 (GRCm39) D103E possibly damaging Het
Clstn1 A C 4: 149,728,081 (GRCm39) D583A possibly damaging Het
Corin A G 5: 72,490,138 (GRCm39) probably benign Het
Cryba1 T C 11: 77,610,283 (GRCm39) D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 (GRCm39) probably null Het
Dis3l T C 9: 64,214,408 (GRCm39) T1027A possibly damaging Het
Dop1b A G 16: 93,559,213 (GRCm39) E653G probably benign Het
Dst A G 1: 34,227,758 (GRCm39) I1459V probably benign Het
Dyrk3 T C 1: 131,057,877 (GRCm39) T64A probably benign Het
Emp2 C T 16: 10,102,479 (GRCm39) C111Y probably benign Het
Fbn1 A T 2: 125,193,984 (GRCm39) C1328S probably benign Het
Gata3 T C 2: 9,879,386 (GRCm39) T197A probably benign Het
Gm1043 A G 5: 37,344,573 (GRCm39) T212A probably damaging Het
H2-Eb1 T C 17: 34,534,006 (GRCm39) probably benign Het
Hand1 T C 11: 57,722,506 (GRCm39) H36R probably damaging Het
Hmgcs2 C A 3: 98,204,317 (GRCm39) Y239* probably null Het
Hoxc12 A G 15: 102,845,490 (GRCm39) Y68C probably damaging Het
Inpp5a A G 7: 139,096,579 (GRCm39) I143V probably benign Het
Klhdc2 C A 12: 69,343,822 (GRCm39) F18L probably benign Het
Kpnb1 T C 11: 97,069,130 (GRCm39) Y251C probably damaging Het
Lrch4 A T 5: 137,635,570 (GRCm39) N315I probably damaging Het
Map3k10 A C 7: 27,367,780 (GRCm39) V286G probably damaging Het
Myo7b G A 18: 32,138,602 (GRCm39) probably benign Het
Nlrp2 G T 7: 5,322,221 (GRCm39) L809I probably damaging Het
Oacyl T C 18: 65,870,896 (GRCm39) probably benign Het
Or4q3 A G 14: 50,583,374 (GRCm39) V175A possibly damaging Het
Paxbp1 T A 16: 90,833,424 (GRCm39) D270V probably damaging Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pira13 T C 7: 3,819,871 (GRCm39) N564S possibly damaging Het
Plcb3 G A 19: 6,940,760 (GRCm39) R359C probably damaging Het
Plcxd3 G A 15: 4,546,350 (GRCm39) S118N probably damaging Het
Ptpn14 T C 1: 189,583,144 (GRCm39) S664P possibly damaging Het
Sirt1 T C 10: 63,159,752 (GRCm39) I443V possibly damaging Het
Slc7a8 G A 14: 54,972,643 (GRCm39) probably benign Het
Smim14 A G 5: 65,610,682 (GRCm39) probably benign Het
Sost C T 11: 101,857,744 (GRCm39) C19Y probably benign Het
Tcaf1 G T 6: 42,652,301 (GRCm39) A727E probably damaging Het
Thoc1 T C 18: 9,963,829 (GRCm39) L144P probably damaging Het
Tmem132b A T 5: 125,860,485 (GRCm39) T577S possibly damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tshr T C 12: 91,505,060 (GRCm39) F666S probably damaging Het
Wdr1 A G 5: 38,698,205 (GRCm39) V192A possibly damaging Het
Zfp697 T C 3: 98,335,482 (GRCm39) W416R probably damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88,649,343 (GRCm39) missense possibly damaging 0.83
IGL01611:Enam APN 5 88,651,608 (GRCm39) missense probably damaging 0.99
IGL01802:Enam APN 5 88,651,533 (GRCm39) missense possibly damaging 0.93
IGL02220:Enam APN 5 88,652,418 (GRCm39) nonsense probably null
IGL02371:Enam APN 5 88,650,668 (GRCm39) missense probably benign 0.39
IGL02596:Enam APN 5 88,650,885 (GRCm39) missense probably benign 0.01
IGL03026:Enam APN 5 88,651,158 (GRCm39) missense probably benign 0.38
IGL03303:Enam APN 5 88,652,450 (GRCm39) missense probably benign 0.12
opinionated UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
recalcitrant UTSW 5 88,651,650 (GRCm39) nonsense probably null
R0200:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0230:Enam UTSW 5 88,637,514 (GRCm39) splice site probably benign
R0395:Enam UTSW 5 88,649,367 (GRCm39) missense probably damaging 0.99
R0548:Enam UTSW 5 88,650,964 (GRCm39) missense probably damaging 0.96
R0608:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0927:Enam UTSW 5 88,641,919 (GRCm39) missense possibly damaging 0.72
R1023:Enam UTSW 5 88,649,826 (GRCm39) missense probably damaging 0.99
R1053:Enam UTSW 5 88,651,878 (GRCm39) missense possibly damaging 0.64
R1169:Enam UTSW 5 88,651,117 (GRCm39) missense probably damaging 1.00
R1230:Enam UTSW 5 88,641,927 (GRCm39) missense probably damaging 0.99
R1324:Enam UTSW 5 88,641,927 (GRCm39) missense possibly damaging 0.53
R1663:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1727:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1750:Enam UTSW 5 88,651,086 (GRCm39) missense probably damaging 1.00
R1852:Enam UTSW 5 88,652,324 (GRCm39) missense possibly damaging 0.92
R1907:Enam UTSW 5 88,652,481 (GRCm39) missense possibly damaging 0.86
R2104:Enam UTSW 5 88,649,646 (GRCm39) missense probably damaging 1.00
R2143:Enam UTSW 5 88,640,779 (GRCm39) missense probably benign 0.02
R2196:Enam UTSW 5 88,650,603 (GRCm39) missense probably damaging 0.99
R2363:Enam UTSW 5 88,651,008 (GRCm39) missense probably benign 0.24
R2497:Enam UTSW 5 88,650,553 (GRCm39) missense probably benign 0.13
R3615:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3616:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3782:Enam UTSW 5 88,650,674 (GRCm39) missense probably damaging 1.00
R4067:Enam UTSW 5 88,651,236 (GRCm39) missense probably damaging 1.00
R4349:Enam UTSW 5 88,651,407 (GRCm39) missense probably damaging 0.99
R4604:Enam UTSW 5 88,652,142 (GRCm39) missense possibly damaging 0.93
R4649:Enam UTSW 5 88,640,827 (GRCm39) missense probably benign 0.02
R4702:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4703:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4704:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4705:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4714:Enam UTSW 5 88,651,395 (GRCm39) missense probably damaging 1.00
R4748:Enam UTSW 5 88,649,402 (GRCm39) missense probably damaging 1.00
R4838:Enam UTSW 5 88,640,967 (GRCm39) nonsense probably null
R4840:Enam UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
R4856:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4886:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4910:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R4911:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R6103:Enam UTSW 5 88,650,187 (GRCm39) missense probably damaging 0.96
R6651:Enam UTSW 5 88,650,776 (GRCm39) missense probably damaging 0.98
R6759:Enam UTSW 5 88,649,550 (GRCm39) missense probably damaging 1.00
R7282:Enam UTSW 5 88,650,186 (GRCm39) missense probably damaging 0.99
R7365:Enam UTSW 5 88,649,347 (GRCm39) missense possibly damaging 0.75
R7392:Enam UTSW 5 88,649,523 (GRCm39) missense probably damaging 0.99
R7483:Enam UTSW 5 88,649,679 (GRCm39) missense probably damaging 1.00
R7647:Enam UTSW 5 88,650,884 (GRCm39) missense probably benign 0.00
R7648:Enam UTSW 5 88,652,016 (GRCm39) missense possibly damaging 0.89
R7672:Enam UTSW 5 88,651,830 (GRCm39) missense possibly damaging 0.80
R7943:Enam UTSW 5 88,636,410 (GRCm39) splice site probably null
R7999:Enam UTSW 5 88,651,561 (GRCm39) missense probably benign
R8117:Enam UTSW 5 88,651,385 (GRCm39) missense probably benign 0.00
R8419:Enam UTSW 5 88,651,209 (GRCm39) missense possibly damaging 0.80
R8528:Enam UTSW 5 88,650,078 (GRCm39) missense probably damaging 0.98
R8836:Enam UTSW 5 88,639,124 (GRCm39) critical splice donor site probably null
R8973:Enam UTSW 5 88,641,947 (GRCm39) missense possibly damaging 0.96
R9001:Enam UTSW 5 88,637,388 (GRCm39) missense probably benign 0.11
R9033:Enam UTSW 5 88,646,475 (GRCm39) missense probably benign 0.01
R9268:Enam UTSW 5 88,640,778 (GRCm39) missense probably benign 0.01
R9723:Enam UTSW 5 88,652,241 (GRCm39) missense probably damaging 1.00
X0018:Enam UTSW 5 88,650,550 (GRCm39) nonsense probably null
Z1176:Enam UTSW 5 88,640,830 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGAAATGACACTAGCCCAATAGG -3'
(R):5'- TTGTTTGAGGCCGGATTAGCTCCC -3'

Sequencing Primer
(F):5'- ACAGTTCAAAACGGTGTCTTCC -3'
(R):5'- CTCCCACAAAGGGTTTGTTTGAG -3'
Posted On 2013-07-30