Incidental Mutation 'R0724:Tmem132b'
ID63811
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Nametransmembrane protein 132B
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0724 (G1)
Quality Score117
Status Validated
Chromosome5
Chromosomal Location125531774-125792583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125783421 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 577 (T577S)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031446
AA Change: T577S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: T577S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125698728 missense probably benign
IGL01518:Tmem132b APN 5 125778791 missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125622494 missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125787575 missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125778727 missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125787547 missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125787724 missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125785926 missense probably damaging 1.00
R1137:Tmem132b UTSW 5 125783542 missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125787019 missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125638249 missense probably benign 0.01
R1689:Tmem132b UTSW 5 125787614 missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125778844 critical splice donor site probably null
R1835:Tmem132b UTSW 5 125785899 missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125623016 missense probably benign
R2033:Tmem132b UTSW 5 125749289 missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125638208 missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R3807:Tmem132b UTSW 5 125787580 missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125783433 missense probably benign
R5149:Tmem132b UTSW 5 125622925 missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125787733 missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125623352 missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125622646 missense probably benign 0.04
R5775:Tmem132b UTSW 5 125638330 critical splice donor site probably null
R7012:Tmem132b UTSW 5 125698590 missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125622673 missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125787646 missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125787491 missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125638268 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCGCTGCATTTCCTCTGAC -3'
(R):5'- CACGCTGATTGCGAATATGGACAC -3'

Sequencing Primer
(F):5'- TCCTCTGACAGTCAGGCTGAG -3'
(R):5'- ATACCTGCACAGTGGTGATGC -3'
Posted On2013-07-30