Incidental Mutation 'R0724:Lrch4'
ID63812
Institutional Source Beutler Lab
Gene Symbol Lrch4
Ensembl Gene ENSMUSG00000093445
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms2810008P14Rik, LRN, LRRN4, 2900069C24Rik, SAP25
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R0724 (G1)
Quality Score102
Status Validated
Chromosome5
Chromosomal Location137629121-137641099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137637308 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 315 (N315I)
Ref Sequence ENSEMBL: ENSMUSP00000135286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176011] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000177477] [ENSMUST00000177545]
Predicted Effect probably damaging
Transcript: ENSMUST00000031734
AA Change: N315I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445
AA Change: N315I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175968
AA Change: N261I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445
AA Change: N261I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176011
SMART Domains Protein: ENSMUSP00000135133
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176256
Predicted Effect probably damaging
Transcript: ENSMUST00000176667
AA Change: N315I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445
AA Change: N315I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176768
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177354
Predicted Effect probably benign
Transcript: ENSMUST00000177466
Predicted Effect probably benign
Transcript: ENSMUST00000177477
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177545
AA Change: N315I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720
AA Change: N315I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Meta Mutation Damage Score 0.4879 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Lrch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrch4 APN 5 137637747 missense possibly damaging 0.49
IGL01862:Lrch4 APN 5 137637009 missense probably damaging 1.00
IGL03289:Lrch4 APN 5 137633577 missense probably damaging 1.00
R0144:Lrch4 UTSW 5 137638543 critical splice donor site probably null
R1330:Lrch4 UTSW 5 137637789 missense probably damaging 0.99
R1557:Lrch4 UTSW 5 137637556 missense probably benign 0.00
R1694:Lrch4 UTSW 5 137638461 missense probably benign 0.00
R2358:Lrch4 UTSW 5 137638548 unclassified probably benign
R3755:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R3756:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R4608:Lrch4 UTSW 5 137639146 nonsense probably null
R5056:Lrch4 UTSW 5 137636851 missense probably damaging 1.00
R5114:Lrch4 UTSW 5 137637917 missense probably benign
R5181:Lrch4 UTSW 5 137629403 missense probably damaging 1.00
R5325:Lrch4 UTSW 5 137637906 missense probably damaging 1.00
R5430:Lrch4 UTSW 5 137638533 missense possibly damaging 0.46
R5712:Lrch4 UTSW 5 137637926 missense possibly damaging 0.57
R5846:Lrch4 UTSW 5 137633657 missense probably damaging 1.00
R5909:Lrch4 UTSW 5 137633865 missense possibly damaging 0.87
R7319:Lrch4 UTSW 5 137639715 missense
R7525:Lrch4 UTSW 5 137639465 missense probably damaging 1.00
R7761:Lrch4 UTSW 5 137639763 missense
R7848:Lrch4 UTSW 5 137633854 missense probably damaging 1.00
R7931:Lrch4 UTSW 5 137633854 missense probably damaging 1.00
RF009:Lrch4 UTSW 5 137637543 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAAGAACTCCCCTGGATTCCAGTG -3'
(R):5'- TCACCCATGATTTCCTGGGCAAAC -3'

Sequencing Primer
(F):5'- CCTGGATTCCAGTGGGAGG -3'
(R):5'- CATATGGGTTCAGGCTGCAC -3'
Posted On2013-07-30