Incidental Mutation 'R8279:Tmprss3'
ID638128
Institutional Source Beutler Lab
Gene Symbol Tmprss3
Ensembl Gene ENSMUSG00000024034
Gene Nametransmembrane protease, serine 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8279 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location31179272-31198975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31197735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000110196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024833] [ENSMUST00000114549]
Predicted Effect probably benign
Transcript: ENSMUST00000024833
SMART Domains Protein: ENSMUSP00000024833
Gene: ENSMUSG00000024034

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
LDLa 72 109 1.76e-5 SMART
SR 108 205 3.99e-4 SMART
Tryp_SPc 216 443 5.22e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114549
AA Change: V9E

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110196
Gene: ENSMUSG00000024034
AA Change: V9E

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
LDLa 94 131 1.76e-5 SMART
SR 130 227 3.99e-4 SMART
Tryp_SPc 238 465 5.22e-96 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit early onset deafness and disrupted vestibular function associated with hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,746,499 M109K probably benign Het
Abcb11 T C 2: 69,239,205 N1282S probably benign Het
Als2cl A G 9: 110,894,585 H683R probably damaging Het
Ank2 C T 3: 126,933,171 D825N probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
C3 A G 17: 57,215,809 V1025A probably benign Het
Cc2d2a T C 5: 43,736,145 S1489P probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdk14 G A 5: 5,266,125 probably benign Het
Clpb T C 7: 101,706,488 V183A possibly damaging Het
Cpa3 C T 3: 20,223,314 M232I possibly damaging Het
Cyp2j7 A G 4: 96,228,559 probably null Het
Dnah2 A G 11: 69,475,573 I1907T probably damaging Het
Efemp1 T C 11: 28,921,795 F437L possibly damaging Het
Fat1 T A 8: 45,030,347 probably null Het
Fry A T 5: 150,496,261 T599S Het
Gm10142 T A 10: 77,716,167 *121R probably null Het
Kcng3 A C 17: 83,587,825 F404C probably damaging Het
Mefv T G 16: 3,715,222 H395P unknown Het
Mrc1 T A 2: 14,266,357 D357E possibly damaging Het
Muc15 A G 2: 110,731,707 T163A probably benign Het
Ncdn T C 4: 126,750,406 T208A probably benign Het
Olfr450 A T 6: 42,817,623 I51F probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdpk1 A G 17: 24,088,173 S395P probably benign Het
Slc27a6 T C 18: 58,572,179 V211A probably benign Het
Slco3a1 T C 7: 74,284,396 D676G possibly damaging Het
Slfn4 T G 11: 83,186,656 M90R possibly damaging Het
Ssbp4 T C 8: 70,602,305 D68G probably damaging Het
Sval3 A G 6: 41,972,437 T70A possibly damaging Het
Taf1c C T 8: 119,599,011 R704Q probably benign Het
Tex15 T A 8: 33,571,737 D398E probably damaging Het
Other mutations in Tmprss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tmprss3 APN 17 31195008 missense probably damaging 0.97
IGL01836:Tmprss3 APN 17 31191044 missense probably benign
IGL02525:Tmprss3 APN 17 31194891 splice site probably benign
IGL02672:Tmprss3 APN 17 31191007 missense probably damaging 1.00
IGL02900:Tmprss3 APN 17 31184579 missense probably damaging 1.00
R0122:Tmprss3 UTSW 17 31193902 splice site probably benign
R0617:Tmprss3 UTSW 17 31193912 missense probably damaging 1.00
R4001:Tmprss3 UTSW 17 31186559 missense probably damaging 1.00
R5587:Tmprss3 UTSW 17 31193992 missense probably benign 0.00
R6077:Tmprss3 UTSW 17 31189167 missense possibly damaging 0.94
R6271:Tmprss3 UTSW 17 31186562 missense probably damaging 1.00
R6329:Tmprss3 UTSW 17 31183859 nonsense probably null
R6918:Tmprss3 UTSW 17 31188357 missense probably benign 0.19
R8372:Tmprss3 UTSW 17 31184697 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTGTAAGAGGGGATCCC -3'
(R):5'- AAGCCACTCTGCGATTTTCTG -3'

Sequencing Primer
(F):5'- GACACTTGACCACATTCATCCCTC -3'
(R):5'- CGATTTTCTGTGGTCTCGAGAAAG -3'
Posted On2020-07-28