Incidental Mutation 'R8280:Olfr1228'
ID 638135
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Name olfactory receptor 1228
Synonyms MOR233-1, GA_x6K02T2Q125-50696209-50695274
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8280 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89247964-89254062 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89248890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 268 (I268K)
Ref Sequence ENSEMBL: ENSMUSP00000139920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190757]
AlphaFold Q8VGM9
Predicted Effect probably damaging
Transcript: ENSMUST00000190757
AA Change: I268K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: I268K

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,841 V248A possibly damaging Het
Alpk2 A G 18: 65,307,203 I373T probably benign Het
Anxa1 A T 19: 20,375,286 M308K possibly damaging Het
Apob T C 12: 8,010,851 M3111T possibly damaging Het
Cacna1e T C 1: 154,469,093 D1095G probably damaging Het
Cacna2d3 C T 14: 28,982,371 V818I probably benign Het
Ces1c T A 8: 93,099,181 H550L possibly damaging Het
Cluap1 A G 16: 3,911,153 probably benign Het
Cped1 G T 6: 21,986,821 R4L unknown Het
Cyb561d1 A G 3: 108,199,216 I229T probably benign Het
Cyb561d1 A G 3: 108,199,397 C169R probably damaging Het
Dip2a C T 10: 76,264,776 V1522M possibly damaging Het
Diras2 A G 13: 52,507,827 M148T probably benign Het
Dnah5 G T 15: 28,408,392 A3508S probably benign Het
Fam43b T C 4: 138,395,970 E13G probably damaging Het
Farsa T G 8: 84,861,179 I113S probably damaging Het
Fcrls G T 3: 87,259,057 S137* probably null Het
Fer1l4 T C 2: 156,049,700 D114G probably damaging Het
Gm4181 A T 14: 51,630,558 *185R probably null Het
Gm5901 G A 7: 105,377,898 probably null Het
Heatr4 C A 12: 83,969,896 E532D probably benign Het
Il10 C T 1: 131,020,012 P34L possibly damaging Het
Lilra6 A G 7: 3,913,047 L271P probably benign Het
Mlh1 A T 9: 111,249,218 probably null Het
Mrvi1 T C 7: 110,923,621 E205G possibly damaging Het
Naaa T C 5: 92,263,449 Y293C probably damaging Het
Ndufaf7 G A 17: 78,943,846 G227R possibly damaging Het
Nmral1 A G 16: 4,713,795 S199P probably damaging Het
Olfr108 T C 17: 37,445,853 F100L probably benign Het
Olfr1269 C A 2: 90,119,398 V67L probably benign Het
Olfr1416 T C 1: 92,480,007 I205V noncoding transcript Het
Olfr730 A C 14: 50,186,266 L318* probably null Het
Olfr917 T A 9: 38,665,487 Y119F probably damaging Het
Olfr935 C T 9: 38,994,779 V219I probably benign Het
Paxbp1 G T 16: 91,034,235 H418N probably benign Het
Prtg A G 9: 72,906,151 Y931C probably damaging Het
Robo4 T C 9: 37,404,076 S239P probably benign Het
Rragd A G 4: 32,995,112 R76G probably benign Het
Samd8 G A 14: 21,780,151 W278* probably null Het
Slc22a8 T A 19: 8,609,263 Y379* probably null Het
Taar8c T A 10: 24,100,937 I326F probably benign Het
Tmem245 A T 4: 56,890,884 S715T possibly damaging Het
Tnnt3 A G 7: 142,501,622 I1M unknown Het
Trio A G 15: 27,902,910 I214T unknown Het
Uqcrfs1 A T 13: 30,545,088 S54T probably benign Het
Usf3 A G 16: 44,218,501 T1115A probably benign Het
Zscan4f A T 7: 11,517,672 I212F probably damaging Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 splice site probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 splice site probably null
R7548:Olfr1228 UTSW 2 89249086 missense probably benign 0.09
R8014:Olfr1228 UTSW 2 89248999 missense probably damaging 0.98
R8098:Olfr1228 UTSW 2 89249308 missense possibly damaging 0.95
R8554:Olfr1228 UTSW 2 89249251 missense possibly damaging 0.48
R8678:Olfr1228 UTSW 2 89249007 missense probably damaging 1.00
R8725:Olfr1228 UTSW 2 89249314 missense probably benign 0.00
R9039:Olfr1228 UTSW 2 89249201 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTTGGGAAGAGACCTTGGC -3'
(R):5'- GTTTTCTAACAGTGGGTCTATCAG -3'

Sequencing Primer
(F):5'- GCATAACAAATGTTCTTACCCACTGG -3'
(R):5'- CAGTGGGTCTATCAGCATCATAATC -3'
Posted On 2020-07-28