Incidental Mutation 'R8280:Fam43b'
ID638143
Institutional Source Beutler Lab
Gene Symbol Fam43b
Ensembl Gene ENSMUSG00000078235
Gene Namefamily with sequence similarity 43, member B
SynonymsOTTMUSG00000009974
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R8280 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location138394092-138396528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138395970 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000100649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105032]
Predicted Effect probably damaging
Transcript: ENSMUST00000105032
AA Change: E13G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100649
Gene: ENSMUSG00000078235
AA Change: E13G

DomainStartEndE-ValueType
Pfam:PID_2 71 265 3.4e-75 PFAM
low complexity region 306 315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,841 V248A possibly damaging Het
Alpk2 A G 18: 65,307,203 I373T probably benign Het
Anxa1 A T 19: 20,375,286 M308K possibly damaging Het
Apob T C 12: 8,010,851 M3111T possibly damaging Het
Cacna1e T C 1: 154,469,093 D1095G probably damaging Het
Cacna2d3 C T 14: 28,982,371 V818I probably benign Het
Ces1c T A 8: 93,099,181 H550L possibly damaging Het
Cluap1 A G 16: 3,911,153 probably benign Het
Cped1 G T 6: 21,986,821 R4L unknown Het
Cyb561d1 A G 3: 108,199,397 C169R probably damaging Het
Cyb561d1 A G 3: 108,199,216 I229T probably benign Het
Dip2a C T 10: 76,264,776 V1522M possibly damaging Het
Diras2 A G 13: 52,507,827 M148T probably benign Het
Dnah5 G T 15: 28,408,392 A3508S probably benign Het
Farsa T G 8: 84,861,179 I113S probably damaging Het
Fcrls G T 3: 87,259,057 S137* probably null Het
Fer1l4 T C 2: 156,049,700 D114G probably damaging Het
Gm4181 A T 14: 51,630,558 *185R probably null Het
Gm5901 G A 7: 105,377,898 probably null Het
Heatr4 C A 12: 83,969,896 E532D probably benign Het
Il10 C T 1: 131,020,012 P34L possibly damaging Het
Lilra6 A G 7: 3,913,047 L271P probably benign Het
Mlh1 A T 9: 111,249,218 probably null Het
Mrvi1 T C 7: 110,923,621 E205G possibly damaging Het
Naaa T C 5: 92,263,449 Y293C probably damaging Het
Ndufaf7 G A 17: 78,943,846 G227R possibly damaging Het
Nmral1 A G 16: 4,713,795 S199P probably damaging Het
Olfr108 T C 17: 37,445,853 F100L probably benign Het
Olfr1228 A T 2: 89,248,890 I268K probably damaging Het
Olfr1269 C A 2: 90,119,398 V67L probably benign Het
Olfr1416 T C 1: 92,480,007 I205V noncoding transcript Het
Olfr730 A C 14: 50,186,266 L318* probably null Het
Olfr917 T A 9: 38,665,487 Y119F probably damaging Het
Olfr935 C T 9: 38,994,779 V219I probably benign Het
Paxbp1 G T 16: 91,034,235 H418N probably benign Het
Prtg A G 9: 72,906,151 Y931C probably damaging Het
Robo4 T C 9: 37,404,076 S239P probably benign Het
Rragd A G 4: 32,995,112 R76G probably benign Het
Samd8 G A 14: 21,780,151 W278* probably null Het
Slc22a8 T A 19: 8,609,263 Y379* probably null Het
Taar8c T A 10: 24,100,937 I326F probably benign Het
Tmem245 A T 4: 56,890,884 S715T possibly damaging Het
Tnnt3 A G 7: 142,501,622 I1M unknown Het
Trio A G 15: 27,902,910 I214T unknown Het
Uqcrfs1 A T 13: 30,545,088 S54T probably benign Het
Usf3 A G 16: 44,218,501 T1115A probably benign Het
Zscan4f A T 7: 11,517,672 I212F probably damaging Het
Other mutations in Fam43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2128:Fam43b UTSW 4 138395988 missense possibly damaging 0.87
R2258:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2281:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2413:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2416:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2417:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3705:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3715:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3797:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3798:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3854:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3856:Fam43b UTSW 4 138395098 missense probably benign 0.25
R4639:Fam43b UTSW 4 138395967 missense possibly damaging 0.66
R4868:Fam43b UTSW 4 138395797 missense probably benign 0.32
R5129:Fam43b UTSW 4 138395472 nonsense probably null
R6176:Fam43b UTSW 4 138395211 missense probably damaging 0.99
R7296:Fam43b UTSW 4 138395841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAGTTTCATCTTCGTGC -3'
(R):5'- CTCTCACAAGGACTGTCTTCG -3'

Sequencing Primer
(F):5'- TTGCCCAGGTACCACACG -3'
(R):5'- AAGGACTGTCTTCGGCCGC -3'
Posted On2020-07-28