Incidental Mutation 'R8280:Naaa'
ID638144
Institutional Source Beutler Lab
Gene Symbol Naaa
Ensembl Gene ENSMUSG00000029413
Gene NameN-acylethanolamine acid amidase
Synonyms3830414F09Rik, Asahl, 2210023K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8280 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92257659-92278170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92263449 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 293 (Y293C)
Ref Sequence ENSEMBL: ENSMUSP00000108726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113102] [ENSMUST00000159345] [ENSMUST00000175656]
Predicted Effect probably damaging
Transcript: ENSMUST00000113102
AA Change: Y293C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413
AA Change: Y293C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159345
AA Change: Y291C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413
AA Change: Y291C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175656
AA Change: Y157C

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,841 V248A possibly damaging Het
Alpk2 A G 18: 65,307,203 I373T probably benign Het
Anxa1 A T 19: 20,375,286 M308K possibly damaging Het
Apob T C 12: 8,010,851 M3111T possibly damaging Het
Cacna1e T C 1: 154,469,093 D1095G probably damaging Het
Cacna2d3 C T 14: 28,982,371 V818I probably benign Het
Ces1c T A 8: 93,099,181 H550L possibly damaging Het
Cluap1 A G 16: 3,911,153 probably benign Het
Cped1 G T 6: 21,986,821 R4L unknown Het
Cyb561d1 A G 3: 108,199,216 I229T probably benign Het
Cyb561d1 A G 3: 108,199,397 C169R probably damaging Het
Dip2a C T 10: 76,264,776 V1522M possibly damaging Het
Diras2 A G 13: 52,507,827 M148T probably benign Het
Dnah5 G T 15: 28,408,392 A3508S probably benign Het
Fam43b T C 4: 138,395,970 E13G probably damaging Het
Farsa T G 8: 84,861,179 I113S probably damaging Het
Fcrls G T 3: 87,259,057 S137* probably null Het
Fer1l4 T C 2: 156,049,700 D114G probably damaging Het
Gm4181 A T 14: 51,630,558 *185R probably null Het
Gm5901 G A 7: 105,377,898 probably null Het
Heatr4 C A 12: 83,969,896 E532D probably benign Het
Il10 C T 1: 131,020,012 P34L possibly damaging Het
Lilra6 A G 7: 3,913,047 L271P probably benign Het
Mlh1 A T 9: 111,249,218 probably null Het
Mrvi1 T C 7: 110,923,621 E205G possibly damaging Het
Ndufaf7 G A 17: 78,943,846 G227R possibly damaging Het
Nmral1 A G 16: 4,713,795 S199P probably damaging Het
Olfr108 T C 17: 37,445,853 F100L probably benign Het
Olfr1228 A T 2: 89,248,890 I268K probably damaging Het
Olfr1269 C A 2: 90,119,398 V67L probably benign Het
Olfr1416 T C 1: 92,480,007 I205V noncoding transcript Het
Olfr730 A C 14: 50,186,266 L318* probably null Het
Olfr917 T A 9: 38,665,487 Y119F probably damaging Het
Olfr935 C T 9: 38,994,779 V219I probably benign Het
Paxbp1 G T 16: 91,034,235 H418N probably benign Het
Prtg A G 9: 72,906,151 Y931C probably damaging Het
Robo4 T C 9: 37,404,076 S239P probably benign Het
Rragd A G 4: 32,995,112 R76G probably benign Het
Samd8 G A 14: 21,780,151 W278* probably null Het
Slc22a8 T A 19: 8,609,263 Y379* probably null Het
Taar8c T A 10: 24,100,937 I326F probably benign Het
Tmem245 A T 4: 56,890,884 S715T possibly damaging Het
Tnnt3 A G 7: 142,501,622 I1M unknown Het
Trio A G 15: 27,902,910 I214T unknown Het
Uqcrfs1 A T 13: 30,545,088 S54T probably benign Het
Usf3 A G 16: 44,218,501 T1115A probably benign Het
Zscan4f A T 7: 11,517,672 I212F probably damaging Het
Other mutations in Naaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Naaa APN 5 92265133 missense probably benign 0.32
IGL01470:Naaa APN 5 92263648 missense probably damaging 1.00
IGL01990:Naaa APN 5 92268063 missense possibly damaging 0.75
IGL02222:Naaa APN 5 92259550 unclassified probably benign
R0254:Naaa UTSW 5 92265135 missense probably damaging 1.00
R1658:Naaa UTSW 5 92272441 splice site probably null
R1930:Naaa UTSW 5 92278035 missense probably benign
R1931:Naaa UTSW 5 92278035 missense probably benign
R3788:Naaa UTSW 5 92272554 splice site probably null
R4182:Naaa UTSW 5 92272554 splice site probably null
R4373:Naaa UTSW 5 92278143 utr 5 prime probably benign
R4547:Naaa UTSW 5 92263586 splice site probably null
R5198:Naaa UTSW 5 92268045 nonsense probably null
R5732:Naaa UTSW 5 92263455 missense probably damaging 1.00
R6009:Naaa UTSW 5 92259581 missense probably benign
R7037:Naaa UTSW 5 92277075 missense possibly damaging 0.46
R7540:Naaa UTSW 5 92263724 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTGACCATGAGAAACATTGGAAGTC -3'
(R):5'- AGACATTTGGCCTCTTGACCC -3'

Sequencing Primer
(F):5'- ATCATGCCTCTGATCCTTGGAGG -3'
(R):5'- CTCTTGACCCTCTGAATGGAGAG -3'
Posted On2020-07-28