Mutagenetix > Incidental Mutations

Incidental Mutation 'R0724:Nlrp2'

63815

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

038906-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0724 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 5319222 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 809 (L809I)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045022
AA Change: L809I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: L809I

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207520
AA Change: L71I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000207685

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	unclassified	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCGTGTAAGTGTGAAGGCAACCATATC -3'
(R):5'- TTGTCTGTTGGAAGTTCATCCAAGGAG -3'

Sequencing Primer
(F):5'- GTGAAGGCAACCATATCTCTTCTG -3'
(R):5'- ATATGGACCCTTCAATTAGCTGC -3'

Posted On

2013-07-30