Incidental Mutation 'R0724:Inpp5a'
List |< first << previous [record 31 of 55] next >> last >|
ID63816
Institutional Source Beutler Lab
Gene Symbol Inpp5a
Ensembl Gene ENSMUSG00000025477
Gene Nameinositol polyphosphate-5-phosphatase A
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score139
Status Validated
Chromosome7
Chromosomal Location139389109-139579652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139516663 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 143 (I143V)
Ref Sequence ENSEMBL: ENSMUSP00000095589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097975] [ENSMUST00000106098]
Predicted Effect probably benign
Transcript: ENSMUST00000026550
AA Change: I135V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477
AA Change: I135V

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097975
AA Change: I143V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477
AA Change: I143V

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106098
AA Change: I135V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477
AA Change: I135V

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210320
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a gene trapped allele show preweaning lethality, while surviving mice exhibit decreased body size, small cerebellum, and early-onset, slowly progressive Purkinje cell degeneration, gliosis, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Inpp5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Inpp5a APN 7 139516721 missense probably benign 0.00
IGL01354:Inpp5a APN 7 139538234 missense probably damaging 0.99
IGL01734:Inpp5a APN 7 139454090 missense possibly damaging 0.92
IGL02536:Inpp5a APN 7 139567422 missense probably benign 0.17
IGL03023:Inpp5a APN 7 139525786 splice site probably null
IGL03390:Inpp5a APN 7 139525748 missense probably benign 0.01
Anza UTSW 7 139525738 missense probably damaging 1.00
borrego UTSW 7 139525670 missense probably damaging 1.00
Joshua_tree UTSW 7 139574982 missense probably damaging 1.00
PIT4402001:Inpp5a UTSW 7 139511453 missense probably benign 0.02
R0940:Inpp5a UTSW 7 139525738 missense probably damaging 1.00
R1258:Inpp5a UTSW 7 139525744 missense probably damaging 1.00
R2112:Inpp5a UTSW 7 139574961 missense probably damaging 0.99
R2328:Inpp5a UTSW 7 139478094 nonsense probably null
R4223:Inpp5a UTSW 7 139558905 missense possibly damaging 0.72
R4307:Inpp5a UTSW 7 139574963 missense possibly damaging 0.87
R4703:Inpp5a UTSW 7 139558923 missense probably damaging 1.00
R4781:Inpp5a UTSW 7 139478005 missense probably benign 0.11
R4997:Inpp5a UTSW 7 139400738 missense probably benign 0.07
R5762:Inpp5a UTSW 7 139538181 missense possibly damaging 0.95
R6014:Inpp5a UTSW 7 139574982 missense probably damaging 1.00
R6381:Inpp5a UTSW 7 139400673 missense probably benign 0.00
R7255:Inpp5a UTSW 7 139511448 missense probably damaging 0.96
R7324:Inpp5a UTSW 7 139525670 missense probably damaging 1.00
R7362:Inpp5a UTSW 7 139578380 missense probably benign 0.00
R7561:Inpp5a UTSW 7 139567422 missense probably damaging 0.99
R7748:Inpp5a UTSW 7 139574995 missense probably damaging 0.96
Z1177:Inpp5a UTSW 7 139525775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGGATGCCTGCCCTAAGTCTC -3'
(R):5'- TCCAAACCTACATGGCCTCTGACTC -3'

Sequencing Primer
(F):5'- GTGAATGGTAATTCCACAGCC -3'
(R):5'- CACTCATTCTGACAATCAGTGCG -3'
Posted On2013-07-30