Incidental Mutation 'R8280:Usf3'
ID638173
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R8280 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44218501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1115 (T1115A)
Ref Sequence ENSEMBL: ENSMUSP00000112620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000119746
AA Change: T1115A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: T1115A

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169582
AA Change: T1115A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: T1115A

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,841 V248A possibly damaging Het
Alpk2 A G 18: 65,307,203 I373T probably benign Het
Anxa1 A T 19: 20,375,286 M308K possibly damaging Het
Apob T C 12: 8,010,851 M3111T possibly damaging Het
Cacna1e T C 1: 154,469,093 D1095G probably damaging Het
Cacna2d3 C T 14: 28,982,371 V818I probably benign Het
Ces1c T A 8: 93,099,181 H550L possibly damaging Het
Cluap1 A G 16: 3,911,153 probably benign Het
Cped1 G T 6: 21,986,821 R4L unknown Het
Cyb561d1 A G 3: 108,199,397 C169R probably damaging Het
Cyb561d1 A G 3: 108,199,216 I229T probably benign Het
Dip2a C T 10: 76,264,776 V1522M possibly damaging Het
Diras2 A G 13: 52,507,827 M148T probably benign Het
Dnah5 G T 15: 28,408,392 A3508S probably benign Het
Fam43b T C 4: 138,395,970 E13G probably damaging Het
Farsa T G 8: 84,861,179 I113S probably damaging Het
Fcrls G T 3: 87,259,057 S137* probably null Het
Fer1l4 T C 2: 156,049,700 D114G probably damaging Het
Gm4181 A T 14: 51,630,558 *185R probably null Het
Gm5901 G A 7: 105,377,898 probably null Het
Heatr4 C A 12: 83,969,896 E532D probably benign Het
Il10 C T 1: 131,020,012 P34L possibly damaging Het
Lilra6 A G 7: 3,913,047 L271P probably benign Het
Mlh1 A T 9: 111,249,218 probably null Het
Mrvi1 T C 7: 110,923,621 E205G possibly damaging Het
Naaa T C 5: 92,263,449 Y293C probably damaging Het
Ndufaf7 G A 17: 78,943,846 G227R possibly damaging Het
Nmral1 A G 16: 4,713,795 S199P probably damaging Het
Olfr108 T C 17: 37,445,853 F100L probably benign Het
Olfr1228 A T 2: 89,248,890 I268K probably damaging Het
Olfr1269 C A 2: 90,119,398 V67L probably benign Het
Olfr1416 T C 1: 92,480,007 I205V noncoding transcript Het
Olfr730 A C 14: 50,186,266 L318* probably null Het
Olfr917 T A 9: 38,665,487 Y119F probably damaging Het
Olfr935 C T 9: 38,994,779 V219I probably benign Het
Paxbp1 G T 16: 91,034,235 H418N probably benign Het
Prtg A G 9: 72,906,151 Y931C probably damaging Het
Robo4 T C 9: 37,404,076 S239P probably benign Het
Rragd A G 4: 32,995,112 R76G probably benign Het
Samd8 G A 14: 21,780,151 W278* probably null Het
Slc22a8 T A 19: 8,609,263 Y379* probably null Het
Taar8c T A 10: 24,100,937 I326F probably benign Het
Tmem245 A T 4: 56,890,884 S715T possibly damaging Het
Tnnt3 A G 7: 142,501,622 I1M unknown Het
Trio A G 15: 27,902,910 I214T unknown Het
Uqcrfs1 A T 13: 30,545,088 S54T probably benign Het
Zscan4f A T 7: 11,517,672 I212F probably damaging Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 splice site probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
R7379:Usf3 UTSW 16 44220576 missense probably benign 0.33
R7389:Usf3 UTSW 16 44217941 missense probably benign 0.09
R7452:Usf3 UTSW 16 44220034 missense probably benign 0.00
R7606:Usf3 UTSW 16 44218943 missense probably damaging 1.00
R7750:Usf3 UTSW 16 44220521 missense probably benign 0.15
R7765:Usf3 UTSW 16 44219063 missense probably benign 0.28
R7830:Usf3 UTSW 16 44219779 nonsense probably null
R7895:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
R7941:Usf3 UTSW 16 44215561 missense probably damaging 1.00
R8285:Usf3 UTSW 16 44220844 missense probably damaging 1.00
R8421:Usf3 UTSW 16 44217209 missense possibly damaging 0.67
R8692:Usf3 UTSW 16 44219740 missense probably benign 0.00
R8798:Usf3 UTSW 16 44220173 missense probably damaging 0.99
R8824:Usf3 UTSW 16 44215613 missense probably benign 0.12
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Z1176:Usf3 UTSW 16 44220431 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTTGATTTGCCTCCCAAGCAG -3'
(R):5'- GTTTAAAGGGCTGGTCTCCC -3'

Sequencing Primer
(F):5'- CTGCTACTGATGAGCGATGAC -3'
(R):5'- GGCTGGTCTCCCTCTAAAGAG -3'
Posted On2020-07-28