Incidental Mutation 'R8281:Spata31e5'
ID 638181
Institutional Source Beutler Lab
Gene Symbol Spata31e5
Ensembl Gene ENSMUSG00000048411
Gene Name spermatogenesis associated 31 subfamily E member 5
Synonyms Gm597, LOC210962
MMRRC Submission 067704-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8281 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28815203-28819333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28817225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 269 (C269Y)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000059937
AA Change: C269Y

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: C269Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 G A 14: 68,745,334 (GRCm39) T630I possibly damaging Het
Adgrf3 T C 5: 30,402,301 (GRCm39) S576G possibly damaging Het
Asxl1 A G 2: 153,241,321 (GRCm39) R625G probably damaging Het
Atp1a1 A G 3: 101,486,940 (GRCm39) F916L probably benign Het
Axl C T 7: 25,463,379 (GRCm39) D633N probably benign Het
Ccdc168 T G 1: 44,095,698 (GRCm39) D1800A possibly damaging Het
Chd9 A G 8: 91,763,225 (GRCm39) D2350G probably damaging Het
Cic G A 7: 24,971,249 (GRCm39) V327I probably benign Het
Crym T A 7: 119,801,250 (GRCm39) probably benign Het
Cyp3a13 G C 5: 137,892,559 (GRCm39) S495C probably benign Het
D5Ertd579e A T 5: 36,770,664 (GRCm39) F137I Het
Dip2a T C 10: 76,112,438 (GRCm39) T1087A probably damaging Het
Drc7 G A 8: 95,788,805 (GRCm39) E288K possibly damaging Het
Epb41l4a T C 18: 34,011,998 (GRCm39) E174G probably damaging Het
Ern2 T C 7: 121,769,483 (GRCm39) R848G probably damaging Het
F13b G T 1: 139,438,689 (GRCm39) R364S probably benign Het
F2rl1 A G 13: 95,650,585 (GRCm39) L99P probably damaging Het
Fam193a C A 5: 34,600,780 (GRCm39) N171K unknown Het
Fst A G 13: 114,591,777 (GRCm39) S201P probably benign Het
Gm10110 C T 14: 90,135,677 (GRCm39) V76M noncoding transcript Het
Gm8232 A G 14: 44,674,548 (GRCm39) I182V Het
Iqca1l T A 5: 24,754,008 (GRCm39) H417L probably benign Het
Kalrn C T 16: 33,855,431 (GRCm39) W1956* probably null Het
Klk1b16 A G 7: 43,790,971 (GRCm39) M258V probably benign Het
Lta4h G T 10: 93,289,456 (GRCm39) D29Y probably damaging Het
Marchf7 C T 2: 60,064,873 (GRCm39) S383L probably benign Het
Mob3c T C 4: 115,688,635 (GRCm39) I56T probably benign Het
Msl2 T C 9: 100,978,894 (GRCm39) S423P probably benign Het
Otop3 T C 11: 115,235,901 (GRCm39) I511T possibly damaging Het
Pbld2 T G 10: 62,883,805 (GRCm39) L90R probably damaging Het
Pcdh8 A G 14: 80,006,919 (GRCm39) V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Plch2 T A 4: 155,091,430 (GRCm39) M228L probably benign Het
Prkdc T C 16: 15,523,117 (GRCm39) C1180R probably damaging Het
Rasl2-9 A T 7: 5,128,351 (GRCm39) L193* probably null Het
Rbp3 A G 14: 33,678,320 (GRCm39) K756R probably benign Het
Rp1 T C 1: 4,418,139 (GRCm39) E991G probably damaging Het
Slc12a7 G A 13: 73,938,796 (GRCm39) R191H probably damaging Het
Spaca6 A G 17: 18,052,321 (GRCm39) N87S possibly damaging Het
Speer1h T A 5: 11,647,646 (GRCm39) M128K probably damaging Het
Stab2 A T 10: 86,709,728 (GRCm39) V1639E probably damaging Het
Thpo T C 16: 20,544,525 (GRCm39) N235S possibly damaging Het
Tmem63b T A 17: 45,971,722 (GRCm39) H831L probably benign Het
Tomm20l T C 12: 71,158,241 (GRCm39) V8A probably benign Het
Trav13-5 A G 14: 54,032,918 (GRCm39) R3G possibly damaging Het
Vill T C 9: 118,887,547 (GRCm39) S104P probably damaging Het
Other mutations in Spata31e5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Spata31e5 APN 1 28,817,732 (GRCm39) missense possibly damaging 0.94
IGL00885:Spata31e5 APN 1 28,815,926 (GRCm39) missense unknown
IGL01296:Spata31e5 APN 1 28,816,137 (GRCm39) missense probably benign 0.23
IGL01476:Spata31e5 APN 1 28,816,534 (GRCm39) missense probably benign 0.04
IGL02125:Spata31e5 APN 1 28,815,419 (GRCm39) missense possibly damaging 0.91
IGL02410:Spata31e5 APN 1 28,817,712 (GRCm39) missense probably benign 0.25
IGL02982:Spata31e5 APN 1 28,817,135 (GRCm39) missense probably damaging 1.00
IGL03031:Spata31e5 APN 1 28,817,664 (GRCm39) missense probably benign 0.03
IGL03267:Spata31e5 APN 1 28,816,202 (GRCm39) missense probably damaging 1.00
R0294:Spata31e5 UTSW 1 28,817,744 (GRCm39) missense probably benign 0.00
R0433:Spata31e5 UTSW 1 28,816,423 (GRCm39) nonsense probably null
R0485:Spata31e5 UTSW 1 28,817,223 (GRCm39) missense probably damaging 1.00
R0645:Spata31e5 UTSW 1 28,816,011 (GRCm39) missense probably damaging 0.99
R0744:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R0836:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R1036:Spata31e5 UTSW 1 28,816,883 (GRCm39) missense probably benign 0.01
R1302:Spata31e5 UTSW 1 28,815,421 (GRCm39) missense probably benign 0.00
R1394:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1395:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1514:Spata31e5 UTSW 1 28,817,829 (GRCm39) missense possibly damaging 0.83
R1535:Spata31e5 UTSW 1 28,816,505 (GRCm39) missense probably damaging 1.00
R2004:Spata31e5 UTSW 1 28,816,260 (GRCm39) missense probably damaging 1.00
R2021:Spata31e5 UTSW 1 28,817,234 (GRCm39) missense probably damaging 0.98
R2022:Spata31e5 UTSW 1 28,817,234 (GRCm39) missense probably damaging 0.98
R3115:Spata31e5 UTSW 1 28,815,410 (GRCm39) missense possibly damaging 0.92
R3615:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3616:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3862:Spata31e5 UTSW 1 28,816,722 (GRCm39) missense probably damaging 0.98
R4067:Spata31e5 UTSW 1 28,816,712 (GRCm39) missense probably damaging 0.98
R4119:Spata31e5 UTSW 1 28,817,054 (GRCm39) missense probably damaging 0.99
R4415:Spata31e5 UTSW 1 28,816,214 (GRCm39) missense probably benign 0.01
R5010:Spata31e5 UTSW 1 28,816,943 (GRCm39) missense possibly damaging 0.52
R5109:Spata31e5 UTSW 1 28,816,636 (GRCm39) missense possibly damaging 0.46
R5122:Spata31e5 UTSW 1 28,819,141 (GRCm39) missense probably benign 0.00
R5533:Spata31e5 UTSW 1 28,817,163 (GRCm39) missense probably damaging 1.00
R6085:Spata31e5 UTSW 1 28,817,308 (GRCm39) missense possibly damaging 0.55
R6116:Spata31e5 UTSW 1 28,817,780 (GRCm39) missense probably benign 0.01
R6750:Spata31e5 UTSW 1 28,816,495 (GRCm39) missense probably damaging 0.98
R6757:Spata31e5 UTSW 1 28,819,191 (GRCm39) missense probably damaging 0.98
R6774:Spata31e5 UTSW 1 28,815,974 (GRCm39) missense probably benign 0.00
R7156:Spata31e5 UTSW 1 28,815,848 (GRCm39) missense possibly damaging 0.53
R7365:Spata31e5 UTSW 1 28,819,233 (GRCm39) missense probably benign 0.04
R7739:Spata31e5 UTSW 1 28,816,689 (GRCm39) missense possibly damaging 0.72
R7996:Spata31e5 UTSW 1 28,817,487 (GRCm39) missense probably damaging 0.98
R8082:Spata31e5 UTSW 1 28,816,579 (GRCm39) missense probably benign 0.08
R8514:Spata31e5 UTSW 1 28,817,586 (GRCm39) missense probably damaging 1.00
R8944:Spata31e5 UTSW 1 28,816,155 (GRCm39) missense probably benign 0.00
R9042:Spata31e5 UTSW 1 28,816,037 (GRCm39) missense possibly damaging 0.72
R9101:Spata31e5 UTSW 1 28,815,740 (GRCm39) missense probably benign 0.04
R9106:Spata31e5 UTSW 1 28,815,975 (GRCm39) missense probably benign 0.00
R9173:Spata31e5 UTSW 1 28,816,430 (GRCm39) missense probably benign 0.22
R9596:Spata31e5 UTSW 1 28,815,688 (GRCm39) missense probably benign 0.07
R9632:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
R9656:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9659:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9661:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9663:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9710:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGAAAGCTCCCTGAAGCTG -3'
(R):5'- GGTTCAGGAACAAGAAAACCTC -3'

Sequencing Primer
(F):5'- GCTGTTCCTCAGATGGGAG -3'
(R):5'- GTTCAGGAACAAGAAAACCTCCCAAG -3'
Posted On 2020-07-28