Incidental Mutation 'R8281:Gm597'
ID 638181
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8281 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28778144 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 269 (C269Y)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000059937
AA Change: C269Y

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: C269Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
R9656:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9659:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9661:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9663:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9710:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGAAAGCTCCCTGAAGCTG -3'
(R):5'- GGTTCAGGAACAAGAAAACCTC -3'

Sequencing Primer
(F):5'- GCTGTTCCTCAGATGGGAG -3'
(R):5'- GTTCAGGAACAAGAAAACCTCCCAAG -3'
Posted On 2020-07-28