Incidental Mutation 'R8281:Gm8251'
List |< first << previous [record 26 of 48] next >> last >|
ID638182
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44056538 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1800 (D1800A)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168641
AA Change: D1800A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: D1800A

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATGTGAGACTTGCCATGGG -3'
(R):5'- ACAGCGAGGAATGTGTGTTTATAG -3'

Sequencing Primer
(F):5'- CCATGGGTTTTTGCAAGACTC -3'
(R):5'- TCTGAGGTACCTAAAGGCATTCC -3'
Posted On2020-07-28