Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:F13b'

638183

Institutional Source

Beutler Lab

Gene Symbol

F13b

Ensembl Gene

ENSMUSG00000026368

Gene Name

coagulation factor XIII, beta subunit

Synonyms

Cf-13b, Cf13b

MMRRC Submission

067704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139501702-139523752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 139510951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 364 (R364S)

Ref Sequence

ENSEMBL: ENSMUSP00000027615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027615]

AlphaFold

Q07968

Predicted Effect

probably benign
Transcript: ENSMUST00000027615
AA Change: R364S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: R364S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CCP	26	88	1.26e-7	SMART
CCP	92	147	2.11e-9	SMART
CCP	154	209	9.83e-10	SMART
CCP	214	268	7.62e-16	SMART
CCP	275	328	8.62e-15	SMART
CCP	337	390	4.62e-15	SMART
CCP	397	451	3.5e-15	SMART
Blast:CCP	455	516	1e-28	BLAST
CCP	525	579	2.44e-14	SMART
Blast:CCP	583	647	1e-8	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Adgrf3	T	C	5: 30,197,303	S576G	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Chd9	A	G	8: 91,036,597	D2350G	probably damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
Ern2	T	C	7: 122,170,260	R848G	probably damaging	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rbp3	A	G	14: 33,956,363	K756R	probably benign	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het
Vill	T	C	9: 119,058,479	S104P	probably damaging	Het

Other mutations in F13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:F13b	APN	1	139510587	missense	probably benign	0.01
IGL00937:F13b	APN	1	139517360	splice site	probably benign
IGL01138:F13b	APN	1	139517212	missense	probably damaging	0.99
IGL01319:F13b	APN	1	139506793	missense	probably damaging	0.98
IGL01328:F13b	APN	1	139508082	splice site	probably benign
IGL01621:F13b	APN	1	139503851	missense	probably benign	0.00
IGL01843:F13b	APN	1	139516427	missense	probably damaging	1.00
IGL02153:F13b	APN	1	139516377	missense	probably damaging	1.00
IGL02192:F13b	APN	1	139517333	missense	probably damaging	1.00
IGL02555:F13b	APN	1	139517186	missense	probably damaging	1.00
IGL03036:F13b	APN	1	139508115	missense	possibly damaging	0.80
IGL03185:F13b	APN	1	139516386	missense	probably benign	0.03
IGL03303:F13b	APN	1	139513036	missense	possibly damaging	0.67
IGL03335:F13b	APN	1	139522386	missense	probably damaging	1.00
IGL03371:F13b	APN	1	139506936	missense	probably damaging	1.00
R0139:F13b	UTSW	1	139508203	missense	probably damaging	0.96
R0157:F13b	UTSW	1	139503847	missense	probably benign
R0381:F13b	UTSW	1	139510859	missense	probably damaging	0.98
R0492:F13b	UTSW	1	139522559	splice site	probably null
R0589:F13b	UTSW	1	139506933	missense	possibly damaging	0.94
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1515:F13b	UTSW	1	139510965	missense	probably damaging	1.00
R1869:F13b	UTSW	1	139510934	missense	probably benign	0.44
R2047:F13b	UTSW	1	139508223	missense	probably damaging	1.00
R2218:F13b	UTSW	1	139506844	missense	probably benign	0.42
R2878:F13b	UTSW	1	139501747	start codon destroyed	probably null
R3032:F13b	UTSW	1	139517333	missense	probably damaging	1.00
R4077:F13b	UTSW	1	139501770	missense	unknown
R4079:F13b	UTSW	1	139501770	missense	unknown
R4208:F13b	UTSW	1	139516341	missense	probably damaging	1.00
R4350:F13b	UTSW	1	139516298	missense	probably benign	0.00
R4674:F13b	UTSW	1	139501804	missense	unknown
R4675:F13b	UTSW	1	139501804	missense	unknown
R4972:F13b	UTSW	1	139510923	missense	probably damaging	1.00
R5212:F13b	UTSW	1	139512987	missense	probably benign
R5343:F13b	UTSW	1	139510544	missense	possibly damaging	0.61
R5503:F13b	UTSW	1	139522543	missense	probably benign	0.00
R5984:F13b	UTSW	1	139508212	missense	probably damaging	1.00
R7012:F13b	UTSW	1	139516358	missense	probably benign
R7155:F13b	UTSW	1	139508157	missense	probably damaging	1.00
R7250:F13b	UTSW	1	139516489	critical splice donor site	probably null
R7478:F13b	UTSW	1	139507695	missense	probably benign	0.01
R7779:F13b	UTSW	1	139516386	missense	probably benign	0.03
R7960:F13b	UTSW	1	139503771	nonsense	probably null
R8007:F13b	UTSW	1	139506942	missense	probably benign	0.11
R8043:F13b	UTSW	1	139522448	missense	probably benign
R9034:F13b	UTSW	1	139508223	missense	probably damaging	1.00
Z1088:F13b	UTSW	1	139508202	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- CCAGACATGTTTATTGTTGTCCTTG -3'
(R):5'- TGCAAGCATTAGTGTCTGTCCATG -3'

Sequencing Primer
(F):5'- ATTCACAATCCTCCCATGCTACTAC -3'
(R):5'- GCATTAGTGTCTGTCCATGAATAGAC -3'

Posted On

2020-07-28