Incidental Mutation 'R8281:F13b'
List |< first << previous [record 18 of 48] next >> last >|
ID638183
Institutional Source Beutler Lab
Gene Symbol F13b
Ensembl Gene ENSMUSG00000026368
Gene Namecoagulation factor XIII, beta subunit
SynonymsCf-13b, Cf13b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location139501702-139523752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139510951 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 364 (R364S)
Ref Sequence ENSEMBL: ENSMUSP00000027615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027615]
Predicted Effect probably benign
Transcript: ENSMUST00000027615
AA Change: R364S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: R364S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 26 88 1.26e-7 SMART
CCP 92 147 2.11e-9 SMART
CCP 154 209 9.83e-10 SMART
CCP 214 268 7.62e-16 SMART
CCP 275 328 8.62e-15 SMART
CCP 337 390 4.62e-15 SMART
CCP 397 451 3.5e-15 SMART
Blast:CCP 455 516 1e-28 BLAST
CCP 525 579 2.44e-14 SMART
Blast:CCP 583 647 1e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in F13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:F13b APN 1 139510587 missense probably benign 0.01
IGL00937:F13b APN 1 139517360 splice site probably benign
IGL01138:F13b APN 1 139517212 missense probably damaging 0.99
IGL01319:F13b APN 1 139506793 missense probably damaging 0.98
IGL01328:F13b APN 1 139508082 splice site probably benign
IGL01621:F13b APN 1 139503851 missense probably benign 0.00
IGL01843:F13b APN 1 139516427 missense probably damaging 1.00
IGL02153:F13b APN 1 139516377 missense probably damaging 1.00
IGL02192:F13b APN 1 139517333 missense probably damaging 1.00
IGL02555:F13b APN 1 139517186 missense probably damaging 1.00
IGL03036:F13b APN 1 139508115 missense possibly damaging 0.80
IGL03185:F13b APN 1 139516386 missense probably benign 0.03
IGL03303:F13b APN 1 139513036 missense possibly damaging 0.67
IGL03335:F13b APN 1 139522386 missense probably damaging 1.00
IGL03371:F13b APN 1 139506936 missense probably damaging 1.00
R0139:F13b UTSW 1 139508203 missense probably damaging 0.96
R0157:F13b UTSW 1 139503847 missense probably benign
R0381:F13b UTSW 1 139510859 missense probably damaging 0.98
R0492:F13b UTSW 1 139522559 splice site probably null
R0589:F13b UTSW 1 139506933 missense possibly damaging 0.94
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1515:F13b UTSW 1 139510965 missense probably damaging 1.00
R1869:F13b UTSW 1 139510934 missense probably benign 0.44
R2047:F13b UTSW 1 139508223 missense probably damaging 1.00
R2218:F13b UTSW 1 139506844 missense probably benign 0.42
R2878:F13b UTSW 1 139501747 start codon destroyed probably null
R3032:F13b UTSW 1 139517333 missense probably damaging 1.00
R4077:F13b UTSW 1 139501770 missense unknown
R4079:F13b UTSW 1 139501770 missense unknown
R4208:F13b UTSW 1 139516341 missense probably damaging 1.00
R4350:F13b UTSW 1 139516298 missense probably benign 0.00
R4674:F13b UTSW 1 139501804 missense unknown
R4675:F13b UTSW 1 139501804 missense unknown
R4972:F13b UTSW 1 139510923 missense probably damaging 1.00
R5212:F13b UTSW 1 139512987 missense probably benign
R5343:F13b UTSW 1 139510544 missense possibly damaging 0.61
R5503:F13b UTSW 1 139522543 missense probably benign 0.00
R5984:F13b UTSW 1 139508212 missense probably damaging 1.00
R7012:F13b UTSW 1 139516358 missense probably benign
R7155:F13b UTSW 1 139508157 missense probably damaging 1.00
R7250:F13b UTSW 1 139516489 critical splice donor site probably null
R7478:F13b UTSW 1 139507695 missense probably benign 0.01
R7779:F13b UTSW 1 139516386 missense probably benign 0.03
R7960:F13b UTSW 1 139503771 nonsense probably null
R8007:F13b UTSW 1 139506942 missense probably benign 0.11
R8043:F13b UTSW 1 139522448 missense probably benign
Z1088:F13b UTSW 1 139508202 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCAGACATGTTTATTGTTGTCCTTG -3'
(R):5'- TGCAAGCATTAGTGTCTGTCCATG -3'

Sequencing Primer
(F):5'- ATTCACAATCCTCCCATGCTACTAC -3'
(R):5'- GCATTAGTGTCTGTCCATGAATAGAC -3'
Posted On2020-07-28