Incidental Mutation 'R8281:Mob3c'
ID638187
Institutional Source Beutler Lab
Gene Symbol Mob3c
Ensembl Gene ENSMUSG00000028709
Gene NameMOB kinase activator 3C
SynonymsMOB3C, Mobkl2c, D130076I06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115828092-115836185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115831438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000030477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030477] [ENSMUST00000148409]
Predicted Effect probably benign
Transcript: ENSMUST00000030477
AA Change: I56T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030477
Gene: ENSMUSG00000028709
AA Change: I56T

DomainStartEndE-ValueType
Mob1_phocein 33 207 3.04e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148409
AA Change: I56T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123611
Gene: ENSMUSG00000028709
AA Change: I56T

DomainStartEndE-ValueType
Pfam:Mob1_phocein 31 90 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Mob3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02210:Mob3c APN 4 115833755 missense probably damaging 1.00
R1718:Mob3c UTSW 4 115831644 missense probably benign 0.00
R1989:Mob3c UTSW 4 115831557 missense probably damaging 1.00
R4678:Mob3c UTSW 4 115833771 splice site probably null
R4883:Mob3c UTSW 4 115833731 missense probably benign 0.11
R5610:Mob3c UTSW 4 115833681 missense probably benign 0.17
R7009:Mob3c UTSW 4 115831582 missense probably benign
R7248:Mob3c UTSW 4 115831684 missense probably benign
R7410:Mob3c UTSW 4 115831587 missense probably damaging 1.00
R8039:Mob3c UTSW 4 115831687 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTCATCTTCAAGTCCCTG -3'
(R):5'- AATGCCATATAGCGGGGTGC -3'

Sequencing Primer
(F):5'- AAGTCCCTGTGCCGAGAGATC -3'
(R):5'- TGCTGAGAGCTTGGCGG -3'
Posted On2020-07-28