Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:Adgrf3'

638191

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

MMRRC Submission

067704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30197303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 576 (S576G)

Ref Sequence

ENSEMBL: ENSMUSP00000085440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]

AlphaFold

Q58Y75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088117
AA Change: S576G

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: S576G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125367

SMART Domains

Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Chd9	A	G	8: 91,036,597	D2350G	probably damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
Ern2	T	C	7: 122,170,260	R848G	probably damaging	Het
F13b	G	T	1: 139,510,951	R364S	probably benign	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rbp3	A	G	14: 33,956,363	K756R	probably benign	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het
Vill	T	C	9: 119,058,479	S104P	probably damaging	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1695:Adgrf3	UTSW	5	30203555	missense	probably benign	0.05
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2656:Adgrf3	UTSW	5	30196438	missense	possibly damaging	0.96
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3798:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4080:Adgrf3	UTSW	5	30197369	nonsense	probably null
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4819:Adgrf3	UTSW	5	30198444	missense	possibly damaging	0.66
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
R8717:Adgrf3	UTSW	5	30198581	unclassified	probably benign
R8857:Adgrf3	UTSW	5	30197067	nonsense	probably null
R8926:Adgrf3	UTSW	5	30200448	missense	possibly damaging	0.46
R9391:Adgrf3	UTSW	5	30195073	missense	possibly damaging	0.94
R9446:Adgrf3	UTSW	5	30196959	missense	probably benign	0.01
R9522:Adgrf3	UTSW	5	30199484	missense	possibly damaging	0.90
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGAACACACAGTGAAGGGTTCC -3'
(R):5'- TGAAGGCTGTGGAGACCTTG -3'

Sequencing Primer
(F):5'- CACAGTGAAGGGTTCCATTCATGTC -3'
(R):5'- GAGACCTTGGTTCACAGCTTAAGAC -3'

Posted On

2020-07-28