Incidental Mutation 'R8281:D5Ertd579e'
List |< first << previous [record 13 of 48] next >> last >|
ID638193
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36613320 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 137 (F137I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably benign
Transcript: ENSMUST00000031091
AA Change: F1244I

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: F1244I

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190
AA Change: F137I

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACGTCTTTTCCATGCAGAGTC -3'
(R):5'- GAGAAGAGTGCTCAGACATCAC -3'

Sequencing Primer
(F):5'- TCCATGCAGAGTCAATTATTTACTTC -3'
(R):5'- GAGTGCTCAGACATCACTGGATTC -3'
Posted On2020-07-28