Incidental Mutation 'R8281:Crym'
List |< first << previous [record 11 of 48] next >> last >|
ID638200
Institutional Source Beutler Lab
Gene Symbol Crym
Ensembl Gene ENSMUSG00000030905
Gene Namecrystallin, mu
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120186380-120202111 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 120202027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198] [ENSMUST00000084640]
Predicted Effect probably benign
Transcript: ENSMUST00000033198
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084640
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
PHENOTYPE: At the euthyroid state, homozygotes display a normal growth curve, heart rate and hearing ability but have significantly reduced serum concentrations of triiodothyronine (T3) and thyroxine (T4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Crym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Crym APN 7 120195399 missense probably damaging 0.98
IGL03355:Crym APN 7 120199313 splice site probably null
R0393:Crym UTSW 7 120189749 missense probably benign 0.00
R1538:Crym UTSW 7 120197715 missense probably benign 0.05
R2508:Crym UTSW 7 120201827 missense probably benign 0.08
R3836:Crym UTSW 7 120201216 missense probably benign 0.03
R4328:Crym UTSW 7 120195339 missense probably damaging 1.00
R4723:Crym UTSW 7 120201075 critical splice donor site probably null
R5046:Crym UTSW 7 120195444 missense possibly damaging 0.71
R5122:Crym UTSW 7 120195495 missense probably benign 0.00
R5266:Crym UTSW 7 120199294 missense probably benign 0.00
R5427:Crym UTSW 7 120199222 unclassified probably benign
R5567:Crym UTSW 7 120201893 missense probably benign 0.00
R5570:Crym UTSW 7 120201893 missense probably benign 0.00
R5704:Crym UTSW 7 120201940 splice site probably null
R6835:Crym UTSW 7 120186645 missense probably benign
R7274:Crym UTSW 7 120190519 missense probably benign 0.03
R7536:Crym UTSW 7 120201108 missense probably damaging 1.00
R8062:Crym UTSW 7 120201168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGAAGTTGGCCAGTGC -3'
(R):5'- GGTGGAACCAGAAAGTCCTC -3'

Sequencing Primer
(F):5'- CTCCAGGGGTGGGATGAG -3'
(R):5'- GGTGGAACCAGAAAGTCCTCTACAC -3'
Posted On2020-07-28