Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:Ern2'

638201

Institutional Source

Beutler Lab

Gene Symbol

Ern2

Ensembl Gene

ENSMUSG00000030866

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 2

Synonyms

Ire1b

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122169893-122186207 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122170260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 848 (R848G)

Ref Sequence

ENSEMBL: ENSMUSP00000033153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000033154] [ENSMUST00000206198]

AlphaFold

Q9Z2E3

Predicted Effect

probably damaging
Transcript: ENSMUST00000033153
AA Change: R848G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: R848G

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000033154

SMART Domains

Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	20	35	N/A	INTRINSIC
S_TKc	53	305	7.36e-95	SMART
low complexity region	354	365	N/A	INTRINSIC
Pfam:POLO_box	418	479	4.4e-24	PFAM
Pfam:POLO_box	516	583	3.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206198

Meta Mutation Damage Score

0.6110

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Adgrf3	T	C	5: 30,197,303	S576G	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Chd9	A	G	8: 91,036,597	D2350G	probably damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
F13b	G	T	1: 139,510,951	R364S	probably benign	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rbp3	A	G	14: 33,956,363	K756R	probably benign	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het
Vill	T	C	9: 119,058,479	S104P	probably damaging	Het

Other mutations in Ern2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	122170092	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	122183190	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	122173375	splice site	probably benign
IGL02738:Ern2	APN	7	122182899	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	122181406	splice site	probably benign
IGL03247:Ern2	APN	7	122171671	missense	probably benign	0.02
ernie	UTSW	7	122171661	critical splice donor site	probably null
Ernie2	UTSW	7	122180862	splice site	probably benign
ernie3	UTSW	7	122173819	critical splice acceptor site	probably null
R0165:Ern2	UTSW	7	122179779	missense	probably benign	0.02
R0785:Ern2	UTSW	7	122171661	critical splice donor site	probably null
R0801:Ern2	UTSW	7	122180862	splice site	probably benign
R1345:Ern2	UTSW	7	122177770	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	122177400	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	122173819	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	122173820	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	122176536	missense	probably benign	0.32
R1899:Ern2	UTSW	7	122183842	splice site	probably benign
R1986:Ern2	UTSW	7	122171529	missense	probably benign	0.06
R2055:Ern2	UTSW	7	122183945	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	122173487	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	122171508	missense	probably damaging	0.97
R2894:Ern2	UTSW	7	122181587	missense	possibly damaging	0.94
R3176:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3945:Ern2	UTSW	7	122176530	missense	probably benign	0.10
R4303:Ern2	UTSW	7	122177846	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	122176587	missense	probably benign	0.28
R4943:Ern2	UTSW	7	122173258	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	122179959	missense	probably benign	0.03
R5629:Ern2	UTSW	7	122170166	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	122179907	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	122173272	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	122176646	missense	probably benign	0.05
R6277:Ern2	UTSW	7	122186107	missense	probably benign
R6624:Ern2	UTSW	7	122177783	missense	probably benign	0.00
R6940:Ern2	UTSW	7	122186146	missense	probably benign	0.01
R7491:Ern2	UTSW	7	122170533	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	122173199	missense	probably benign	0.06
R7555:Ern2	UTSW	7	122170241	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	122173708	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	122173208	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	122181292	nonsense	probably null
R8548:Ern2	UTSW	7	122177839	missense	probably damaging	1.00
R8853:Ern2	UTSW	7	122173744	missense	probably damaging	1.00
R8929:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R8931:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R9088:Ern2	UTSW	7	122173667	missense	probably damaging	1.00
R9511:Ern2	UTSW	7	122177600	missense	probably benign	0.03
R9789:Ern2	UTSW	7	122170262	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGGCTCAACTCCTTGGTC -3'
(R):5'- GCCTGCAGATCTGAAAAGGTTCC -3'

Sequencing Primer
(F):5'- TGGACCCTCTGGATGTCTCAG -3'
(R):5'- GATCTGAAAAGGTTCCGCTCATAC -3'

Posted On

2020-07-28