Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:Chd9'

638202

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik

MMRRC Submission

067704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90828352-91054516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91036597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2350 (D2350G)

Ref Sequence

ENSEMBL: ENSMUSP00000105243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048665

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109614
AA Change: D2350G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: D2350G

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209203

Predicted Effect

probably damaging
Transcript: ENSMUST00000209423
AA Change: D2350G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Adgrf3	T	C	5: 30,197,303	S576G	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
Ern2	T	C	7: 122,170,260	R848G	probably damaging	Het
F13b	G	T	1: 139,510,951	R364S	probably benign	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rbp3	A	G	14: 33,956,363	K756R	probably benign	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het
Vill	T	C	9: 119,058,479	S104P	probably damaging	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91025392	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91005798	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91015846	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	90986132	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	90983490	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	90973207	missense	probably benign	0.29
IGL00908:Chd9	APN	8	90996880	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91051692	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91042116	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91026776	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	90933767	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91033510	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	90932488	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	90956494	nonsense	probably null
IGL02164:Chd9	APN	8	90933221	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91051684	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91033582	missense	probably benign	0.33
IGL02892:Chd9	APN	8	90976915	splice site	probably benign
IGL02897:Chd9	APN	8	90933868	splice site	probably benign
IGL03005:Chd9	APN	8	91011447	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91015267	splice site	probably benign
IGL03140:Chd9	APN	8	91042228	missense	possibly damaging	0.91
hovel	UTSW	8	91015204	missense	probably benign	0.19
shack	UTSW	8	90932798	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	90933537	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91008836	splice site	probably null
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	90994450	splice site	probably benign
R0454:Chd9	UTSW	8	90973231	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	90998595	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	90994563	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91036542	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	90977676	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91051197	missense	probably benign	0.06
R0945:Chd9	UTSW	8	90933002	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91015204	missense	probably benign	0.19
R0967:Chd9	UTSW	8	90989479	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	90932578	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	90986136	nonsense	probably null
R1244:Chd9	UTSW	8	91022929	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91006495	splice site	probably null
R1570:Chd9	UTSW	8	91036542	missense	probably benign	0.03
R1591:Chd9	UTSW	8	90983538	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	90998535	missense	probably benign	0.17
R1626:Chd9	UTSW	8	90994596	missense	probably benign	0.00
R1632:Chd9	UTSW	8	90956707	nonsense	probably null
R1649:Chd9	UTSW	8	90932601	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91022790	splice site	probably null
R1668:Chd9	UTSW	8	91041186	missense	probably damaging	0.99
R1681:Chd9	UTSW	8	90973135	missense	probably damaging	0.98
R1695:Chd9	UTSW	8	91001782	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91034225	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91010698	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91010794	missense	probably benign	0.19
R1844:Chd9	UTSW	8	90956695	nonsense	probably null
R1941:Chd9	UTSW	8	90977069	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91035054	missense	probably benign	0.17
R2027:Chd9	UTSW	8	90907991	unclassified	probably benign
R2098:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91011285	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91051128	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91030460	splice site	probably null
R3418:Chd9	UTSW	8	91036591	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	90984265	splice site	probably benign
R3923:Chd9	UTSW	8	90933519	missense	probably benign	0.16
R4001:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	90933560	missense	probably benign	0.12
R4013:Chd9	UTSW	8	90973169	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91023574	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91010676	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	90977680	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	90978999	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91034031	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91036506	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	90983463	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91033800	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91015249	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91034230	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91033708	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91006626	nonsense	probably null
R5083:Chd9	UTSW	8	90984374	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	90977519	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91026834	nonsense	probably null
R5307:Chd9	UTSW	8	90997149	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91051504	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91015925	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91011450	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91036562	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91001756	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	90989450	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	90997164	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91051836	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	90978887	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91035063	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91049137	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	90932417	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	90932922	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91030546	missense	possibly damaging	0.93
R6348:Chd9	UTSW	8	91011275	missense	possibly damaging	0.95
R6438:Chd9	UTSW	8	90998521	missense	probably benign	0.02
R6470:Chd9	UTSW	8	90932798	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91051554	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91042951	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	90956416	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91042945	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	90978914	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91034215	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	90989561	missense	unknown
R7126:Chd9	UTSW	8	91015225	missense	unknown
R7182:Chd9	UTSW	8	91006622	missense	unknown
R7219:Chd9	UTSW	8	91001766	missense	unknown
R7260:Chd9	UTSW	8	90994543	missense	unknown
R7293:Chd9	UTSW	8	91034079	missense	unknown
R7303:Chd9	UTSW	8	91051904	missense	unknown
R7358:Chd9	UTSW	8	90983487	missense	unknown
R7358:Chd9	UTSW	8	91034218	missense	unknown
R7451:Chd9	UTSW	8	91033790	frame shift	probably null
R7451:Chd9	UTSW	8	91033818	missense	probably benign	0.27
R7456:Chd9	UTSW	8	90932525	nonsense	probably null
R7481:Chd9	UTSW	8	90956438	missense	unknown
R7532:Chd9	UTSW	8	90994565	missense	unknown
R7570:Chd9	UTSW	8	90994580	missense	unknown
R7611:Chd9	UTSW	8	91036389	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91051697	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91015209	missense	unknown
R7739:Chd9	UTSW	8	91035025	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	90977550	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91035056	nonsense	probably null
R7921:Chd9	UTSW	8	91042281	critical splice donor site	probably null
R7957:Chd9	UTSW	8	91051698	missense	probably damaging	0.99
R7972:Chd9	UTSW	8	91005767	missense	unknown
R8108:Chd9	UTSW	8	90933224	missense	unknown
R8115:Chd9	UTSW	8	91036332	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91041141	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91025387	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	90998605	missense	unknown
R8208:Chd9	UTSW	8	91037263	splice site	probably null
R8256:Chd9	UTSW	8	90933501	missense	unknown
R8504:Chd9	UTSW	8	90996844	missense	unknown
R8836:Chd9	UTSW	8	91041184	missense	probably damaging	0.99
R8892:Chd9	UTSW	8	90933840	missense	unknown
R8985:Chd9	UTSW	8	90994473	missense	unknown
R9029:Chd9	UTSW	8	90956570	missense	unknown
R9030:Chd9	UTSW	8	90956570	missense	unknown
R9038:Chd9	UTSW	8	90989605	missense	unknown
R9081:Chd9	UTSW	8	90977516	nonsense	probably null
R9134:Chd9	UTSW	8	90933126	missense	unknown
R9205:Chd9	UTSW	8	91030642	missense	probably benign	0.01
R9309:Chd9	UTSW	8	91006691	missense	unknown
R9375:Chd9	UTSW	8	90998707	critical splice donor site	probably null
R9449:Chd9	UTSW	8	90932546	missense	unknown
R9547:Chd9	UTSW	8	90956558	missense	unknown
R9573:Chd9	UTSW	8	90977674	missense	unknown
R9576:Chd9	UTSW	8	90932666	missense	unknown
R9601:Chd9	UTSW	8	91005732	nonsense	probably null
R9613:Chd9	UTSW	8	90956522	nonsense	probably null
R9639:Chd9	UTSW	8	91034212	missense	probably null
R9718:Chd9	UTSW	8	90986173	missense	unknown
R9746:Chd9	UTSW	8	91011435	missense	unknown
R9762:Chd9	UTSW	8	90986113	missense	unknown
R9764:Chd9	UTSW	8	90994592	missense	unknown
R9790:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
R9791:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
RF007:Chd9	UTSW	8	91033950	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91036572	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGTGGCGTCCTTCTATAC -3'
(R):5'- TCAGGAGAGAGGCCTACTTAGTG -3'

Sequencing Primer
(F):5'- TTCTATACCACCAAACTGCTGGATAG -3'
(R):5'- TTAATGGGATGCTCACCCTGAACAG -3'

Posted On

2020-07-28