Incidental Mutation 'R8281:Cmtm1'
List |< first << previous [record 10 of 48] next >> last >|
ID638204
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene NameCKLF-like MARVEL transmembrane domain containing 1
SynonymsCklfsf1, CHLFH1a, CKLFH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R8281 (G1)
Quality Score108.457
Status Not validated
Chromosome8
Chromosomal Location104292622-104310145 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT at 104309470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175]
Predicted Effect probably benign
Transcript: ENSMUST00000159039
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160596
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162616
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212847
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 104309295 missense possibly damaging 0.90
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6821:Cmtm1 UTSW 8 104309702 frame shift probably null
R6822:Cmtm1 UTSW 8 104309702 frame shift probably null
R7028:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7128:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7816:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7819:Cmtm1 UTSW 8 104309702 frame shift probably null
R7841:Cmtm1 UTSW 8 104309476 missense possibly damaging 0.55
R7963:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7988:Cmtm1 UTSW 8 104310142 unclassified probably benign
R8130:Cmtm1 UTSW 8 104309456 missense unknown
R8152:Cmtm1 UTSW 8 104309941 missense possibly damaging 0.83
R8439:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8459:Cmtm1 UTSW 8 104309511 missense possibly damaging 0.95
RF041:Cmtm1 UTSW 8 104309470 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AACATCCCATTGGCTGAGCAG -3'
(R):5'- GTGCTATACCATCCAGGCAG -3'

Sequencing Primer
(F):5'- TGCCAGAAGCTATCTCTGAATC -3'
(R):5'- GGCAGCGACCTTCAGTACAAG -3'
Posted On2020-07-28