Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:Vill'

638206

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119058479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 104 (S104P)

Ref Sequence

ENSEMBL: ENSMUSP00000061731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051386
AA Change: S104P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: S104P

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000074734
AA Change: S104P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: S104P

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131647

SMART Domains

Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
SCOP:d1d4xg_	7	85	6e-23	SMART
Blast:GEL	14	85	1e-48	BLAST
PDB:2VIL\|A	15	82	1e-15	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000136561

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141185

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Adgrf3	T	C	5: 30,197,303	S576G	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Chd9	A	G	8: 91,036,597	D2350G	probably damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
Ern2	T	C	7: 122,170,260	R848G	probably damaging	Het
F13b	G	T	1: 139,510,951	R364S	probably benign	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rbp3	A	G	14: 33,956,363	K756R	probably benign	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3886:Vill	UTSW	9	119066714	missense	probably benign	0.24
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4889:Vill	UTSW	9	119063341	missense	possibly damaging	0.50
R4932:Vill	UTSW	9	119061511	missense	probably damaging	1.00
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6889:Vill	UTSW	9	119065882	missense	possibly damaging	0.58
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8165:Vill	UTSW	9	119066753	missense	probably damaging	0.98
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
R8685:Vill	UTSW	9	119066727	missense	probably benign	0.00
R8847:Vill	UTSW	9	119068446	missense	probably damaging	0.99
R8968:Vill	UTSW	9	119063603	critical splice donor site	probably null
R9290:Vill	UTSW	9	119061494	missense	probably benign	0.03
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCCCTCAGAGTCCAAAAG -3'
(R):5'- CTGGTTGTGTGTATCTGAAACCAATG -3'

Sequencing Primer
(F):5'- AGCTACCCAGGGAGGATTC -3'
(R):5'- GTGAGTGTACCTATCTTAAAGTGCAC -3'

Posted On

2020-07-28