Incidental Mutation 'R8281:Vill'
List |< first << previous [record 48 of 48]
ID638206
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Namevillin-like
SynonymsVillp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119052778-119071525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119058479 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000061731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]
Predicted Effect probably damaging
Transcript: ENSMUST00000051386
AA Change: S104P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: S104P

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074734
AA Change: S104P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: S104P

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131647
SMART Domains Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
SCOP:d1d4xg_ 7 85 6e-23 SMART
Blast:GEL 14 85 1e-48 BLAST
PDB:2VIL|A 15 82 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136561
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 119063312 missense probably damaging 1.00
IGL01024:Vill APN 9 119070350 critical splice donor site probably null
IGL01934:Vill APN 9 119066809 missense probably damaging 1.00
IGL02118:Vill APN 9 119060398 missense probably benign 0.44
IGL02260:Vill APN 9 119058441 missense probably benign 0.00
IGL02507:Vill APN 9 119070777 missense possibly damaging 0.86
IGL02870:Vill APN 9 119061899 missense probably damaging 1.00
IGL02941:Vill APN 9 119066887 unclassified probably benign
IGL02835:Vill UTSW 9 119067445 missense probably benign 0.11
R0285:Vill UTSW 9 119070827 unclassified probably benign
R0571:Vill UTSW 9 119070633 missense possibly damaging 0.93
R1024:Vill UTSW 9 119066824 missense probably damaging 1.00
R1168:Vill UTSW 9 119070321 missense probably damaging 0.99
R1374:Vill UTSW 9 119061494 missense probably benign 0.03
R1400:Vill UTSW 9 119063347 missense probably benign 0.01
R1551:Vill UTSW 9 119063372 missense probably benign
R1584:Vill UTSW 9 119065586 missense probably damaging 1.00
R1630:Vill UTSW 9 119070701 missense probably benign 0.37
R1721:Vill UTSW 9 119066014 missense probably damaging 0.98
R1946:Vill UTSW 9 119058492 missense probably benign
R2311:Vill UTSW 9 119065897 missense probably benign 0.08
R2392:Vill UTSW 9 119067560 unclassified probably benign
R2509:Vill UTSW 9 119070302 missense possibly damaging 0.84
R2760:Vill UTSW 9 119066882 critical splice donor site probably null
R3886:Vill UTSW 9 119066714 missense probably benign 0.24
R3944:Vill UTSW 9 119068431 missense probably benign 0.10
R4245:Vill UTSW 9 119071291 unclassified probably benign
R4246:Vill UTSW 9 119060393 missense probably damaging 1.00
R4771:Vill UTSW 9 119068434 missense probably damaging 1.00
R4889:Vill UTSW 9 119063341 missense possibly damaging 0.50
R4932:Vill UTSW 9 119061511 missense probably damaging 1.00
R4946:Vill UTSW 9 119068440 missense probably damaging 1.00
R5121:Vill UTSW 9 119070025 missense possibly damaging 0.92
R5646:Vill UTSW 9 119071162 missense probably damaging 1.00
R6089:Vill UTSW 9 119057799 missense probably benign 0.00
R6149:Vill UTSW 9 119058414 missense possibly damaging 0.67
R6167:Vill UTSW 9 119066864 missense probably damaging 0.98
R6318:Vill UTSW 9 119063648 missense probably benign 0.15
R6319:Vill UTSW 9 119063648 missense probably benign 0.15
R6590:Vill UTSW 9 119061907 missense probably benign 0.04
R6690:Vill UTSW 9 119061907 missense probably benign 0.04
R6889:Vill UTSW 9 119065882 missense possibly damaging 0.58
R7207:Vill UTSW 9 119071213 missense possibly damaging 0.64
R7353:Vill UTSW 9 119065493 missense probably damaging 0.99
R7398:Vill UTSW 9 119070648 missense probably benign 0.26
R7883:Vill UTSW 9 119065521 nonsense probably null
R8165:Vill UTSW 9 119066753 missense probably damaging 0.98
R8380:Vill UTSW 9 119057849 missense probably benign 0.04
RF005:Vill UTSW 9 119060439 missense probably damaging 1.00
Z1176:Vill UTSW 9 119069965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCCTCAGAGTCCAAAAG -3'
(R):5'- CTGGTTGTGTGTATCTGAAACCAATG -3'

Sequencing Primer
(F):5'- AGCTACCCAGGGAGGATTC -3'
(R):5'- GTGAGTGTACCTATCTTAAAGTGCAC -3'
Posted On2020-07-28