Incidental Mutation 'R0724:Dis3l'
List |< first << previous [record 17 of 55] next >> last >|
ID63821
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene NameDIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R0724 (G1)
Quality Score156
Status Validated
Chromosome9
Chromosomal Location64306756-64341288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64307126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1027 (T1027A)
Ref Sequence ENSEMBL: ENSMUSP00000129772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034964] [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844] [ENSMUST00000216594]
Predicted Effect probably benign
Transcript: ENSMUST00000034964
SMART Domains Protein: ENSMUSP00000034964
Gene: ENSMUSG00000032397

DomainStartEndE-ValueType
low complexity region 19 43 N/A INTRINSIC
Pfam:Swi3 63 143 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068367
AA Change: T944A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: T944A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113890
AA Change: T944A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: T944A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120760
AA Change: T944A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: T944A

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168844
AA Change: T1027A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: T1027A

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216594
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64319254 critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64310237 missense probably benign 0.00
IGL01838:Dis3l APN 9 64308299 missense probably benign 0.41
IGL02104:Dis3l APN 9 64310329 missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64314773 missense probably benign 0.00
IGL02481:Dis3l APN 9 64319080 splice site probably null
IGL02483:Dis3l APN 9 64319080 splice site probably null
IGL02965:Dis3l APN 9 64310484 missense probably damaging 0.99
IGL03139:Dis3l APN 9 64311950 missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64310440 critical splice donor site probably null
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0801:Dis3l UTSW 9 64319154 missense probably benign
R0925:Dis3l UTSW 9 64341130 start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64325787 missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64307489 missense probably benign 0.07
R1794:Dis3l UTSW 9 64317776 missense possibly damaging 0.67
R1929:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2007:Dis3l UTSW 9 64308276 unclassified probably null
R2062:Dis3l UTSW 9 64339573 missense probably benign 0.02
R2152:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2153:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2154:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2186:Dis3l UTSW 9 64339612 nonsense probably null
R2271:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2280:Dis3l UTSW 9 64317794 missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64307497 missense probably benign 0.20
R3156:Dis3l UTSW 9 64311750 missense probably benign 0.25
R4664:Dis3l UTSW 9 64330798 missense unknown
R4775:Dis3l UTSW 9 64330908 missense probably benign 0.16
R4977:Dis3l UTSW 9 64307201 missense probably benign 0.00
R4997:Dis3l UTSW 9 64311942 missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64319216 missense probably damaging 1.00
R5579:Dis3l UTSW 9 64330835 missense probably benign 0.44
R5623:Dis3l UTSW 9 64307603 missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64322575 missense probably benign 0.00
R6442:Dis3l UTSW 9 64307555 missense probably benign
R6505:Dis3l UTSW 9 64307513 missense probably benign 0.15
R6731:Dis3l UTSW 9 64310438 splice site probably null
R7008:Dis3l UTSW 9 64310453 missense possibly damaging 0.96
R7405:Dis3l UTSW 9 64314704 missense probably damaging 1.00
R7555:Dis3l UTSW 9 64311937 nonsense probably null
R7798:Dis3l UTSW 9 64341017 missense probably benign
R7890:Dis3l UTSW 9 64322471 missense probably benign 0.00
R7973:Dis3l UTSW 9 64322471 missense probably benign 0.00
X0020:Dis3l UTSW 9 64325734 missense probably damaging 1.00
X0065:Dis3l UTSW 9 64307054 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCAGAGGAACTCAAGTGTGTCTGTAA -3'
(R):5'- CTGTGCCAGGTAAGAATTTCTGTCCA -3'

Sequencing Primer
(F):5'- gcagaacagccagggatac -3'
(R):5'- GCGCTGCCACTCTGATAC -3'
Posted On2013-07-30