Incidental Mutation 'R8281:Lta4h'
List |< first << previous [record 29 of 48] next >> last >|
ID638210
Institutional Source Beutler Lab
Gene Symbol Lta4h
Ensembl Gene ENSMUSG00000015889
Gene Nameleukotriene A4 hydrolase
SynonymsLTA4 hydrodase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location93453411-93484875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93453594 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 29 (D29Y)
Ref Sequence ENSEMBL: ENSMUSP00000016033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016033]
Predicted Effect probably damaging
Transcript: ENSMUST00000016033
AA Change: D29Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016033
Gene: ENSMUSG00000015889
AA Change: D29Y

DomainStartEndE-ValueType
Pfam:Peptidase_M1 13 387 7.8e-80 PFAM
Leuk-A4-hydro_C 464 608 2.01e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have grossly normal phenotypes. Inflammatory reactions are reduced as are some other immunological responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Lta4h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Lta4h APN 10 93471370 splice site probably benign
IGL02309:Lta4h APN 10 93474490 missense probably damaging 1.00
IGL02351:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02358:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02589:Lta4h APN 10 93474931 missense probably benign 0.01
IGL02649:Lta4h APN 10 93472969 missense probably benign 0.00
IGL03164:Lta4h APN 10 93470797 splice site probably benign
R0498:Lta4h UTSW 10 93471971 splice site probably benign
R1451:Lta4h UTSW 10 93480728 missense probably damaging 0.99
R1690:Lta4h UTSW 10 93484692 missense probably benign
R1837:Lta4h UTSW 10 93469175 missense probably damaging 1.00
R4202:Lta4h UTSW 10 93470807 missense probably damaging 1.00
R4684:Lta4h UTSW 10 93468816 missense probably benign
R5528:Lta4h UTSW 10 93471874 missense probably damaging 1.00
R5637:Lta4h UTSW 10 93468869 splice site probably null
R5873:Lta4h UTSW 10 93469190 critical splice donor site probably null
R6965:Lta4h UTSW 10 93471897 nonsense probably null
R7282:Lta4h UTSW 10 93453511 start codon destroyed probably null 0.98
R7779:Lta4h UTSW 10 93474949 missense probably benign 0.06
R8045:Lta4h UTSW 10 93469106 missense probably damaging 1.00
R8306:Lta4h UTSW 10 93482264 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCTAGCGCTAGCCTGATC -3'
(R):5'- TGCTGATGTAAAAGTGGGGC -3'

Sequencing Primer
(F):5'- TGATCGCGCTGCATCATG -3'
(R):5'- CTGATGTAAAAGTGGGGCTGAGAAAG -3'
Posted On2020-07-28