Incidental Mutation 'R8281:Fst'
ID638215
Institutional Source Beutler Lab
Gene Symbol Fst
Ensembl Gene ENSMUSG00000021765
Gene Namefollistatin
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location114452290-114458951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114455241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000022287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022287]
Predicted Effect probably benign
Transcript: ENSMUST00000022287
AA Change: S201P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: S201P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FOLN 94 117 2.44e-8 SMART
KAZAL 117 164 9.1e-17 SMART
FOLN 167 190 6.45e-8 SMART
KAZAL 191 239 3.73e-13 SMART
FOLN 243 267 2.09e-7 SMART
KAZAL 265 315 3.03e-13 SMART
low complexity region 320 329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Fst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Fst APN 13 114454360 missense probably damaging 1.00
IGL02213:Fst APN 13 114455854 missense possibly damaging 0.51
R0631:Fst UTSW 13 114454502 missense possibly damaging 0.91
R1391:Fst UTSW 13 114454279 critical splice donor site probably benign
R4884:Fst UTSW 13 114454384 missense probably damaging 1.00
R5326:Fst UTSW 13 114455705 missense probably damaging 1.00
R5542:Fst UTSW 13 114455705 missense probably damaging 1.00
R6700:Fst UTSW 13 114458507 missense probably benign 0.00
R7319:Fst UTSW 13 114458532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GACAGTGGCTTTTCAGGAGG -3'
(R):5'- CCAGAAGATGCCGTTTGAAATG -3'

Sequencing Primer
(F):5'- TGGTTAGCCCCCACACTATTAAATC -3'
(R):5'- CAGAAGATGCCGTTTGAAATGTCATC -3'
Posted On2020-07-28