Incidental Mutation 'R8281:Fst'
ID 638215
Institutional Source Beutler Lab
Gene Symbol Fst
Ensembl Gene ENSMUSG00000021765
Gene Name follistatin
Synonyms
MMRRC Submission 067704-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R8281 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 114588826-114595487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114591777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000022287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022287]
AlphaFold P47931
Predicted Effect probably benign
Transcript: ENSMUST00000022287
AA Change: S201P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: S201P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FOLN 94 117 2.44e-8 SMART
KAZAL 117 164 9.1e-17 SMART
FOLN 167 190 6.45e-8 SMART
KAZAL 191 239 3.73e-13 SMART
FOLN 243 267 2.09e-7 SMART
KAZAL 265 315 3.03e-13 SMART
low complexity region 320 329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 G A 14: 68,745,334 (GRCm39) T630I possibly damaging Het
Adgrf3 T C 5: 30,402,301 (GRCm39) S576G possibly damaging Het
Asxl1 A G 2: 153,241,321 (GRCm39) R625G probably damaging Het
Atp1a1 A G 3: 101,486,940 (GRCm39) F916L probably benign Het
Axl C T 7: 25,463,379 (GRCm39) D633N probably benign Het
Ccdc168 T G 1: 44,095,698 (GRCm39) D1800A possibly damaging Het
Chd9 A G 8: 91,763,225 (GRCm39) D2350G probably damaging Het
Cic G A 7: 24,971,249 (GRCm39) V327I probably benign Het
Crym T A 7: 119,801,250 (GRCm39) probably benign Het
Cyp3a13 G C 5: 137,892,559 (GRCm39) S495C probably benign Het
D5Ertd579e A T 5: 36,770,664 (GRCm39) F137I Het
Dip2a T C 10: 76,112,438 (GRCm39) T1087A probably damaging Het
Drc7 G A 8: 95,788,805 (GRCm39) E288K possibly damaging Het
Epb41l4a T C 18: 34,011,998 (GRCm39) E174G probably damaging Het
Ern2 T C 7: 121,769,483 (GRCm39) R848G probably damaging Het
F13b G T 1: 139,438,689 (GRCm39) R364S probably benign Het
F2rl1 A G 13: 95,650,585 (GRCm39) L99P probably damaging Het
Fam193a C A 5: 34,600,780 (GRCm39) N171K unknown Het
Gm10110 C T 14: 90,135,677 (GRCm39) V76M noncoding transcript Het
Gm8232 A G 14: 44,674,548 (GRCm39) I182V Het
Iqca1l T A 5: 24,754,008 (GRCm39) H417L probably benign Het
Kalrn C T 16: 33,855,431 (GRCm39) W1956* probably null Het
Klk1b16 A G 7: 43,790,971 (GRCm39) M258V probably benign Het
Lta4h G T 10: 93,289,456 (GRCm39) D29Y probably damaging Het
Marchf7 C T 2: 60,064,873 (GRCm39) S383L probably benign Het
Mob3c T C 4: 115,688,635 (GRCm39) I56T probably benign Het
Msl2 T C 9: 100,978,894 (GRCm39) S423P probably benign Het
Otop3 T C 11: 115,235,901 (GRCm39) I511T possibly damaging Het
Pbld2 T G 10: 62,883,805 (GRCm39) L90R probably damaging Het
Pcdh8 A G 14: 80,006,919 (GRCm39) V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Plch2 T A 4: 155,091,430 (GRCm39) M228L probably benign Het
Prkdc T C 16: 15,523,117 (GRCm39) C1180R probably damaging Het
Rasl2-9 A T 7: 5,128,351 (GRCm39) L193* probably null Het
Rbp3 A G 14: 33,678,320 (GRCm39) K756R probably benign Het
Rp1 T C 1: 4,418,139 (GRCm39) E991G probably damaging Het
Slc12a7 G A 13: 73,938,796 (GRCm39) R191H probably damaging Het
Spaca6 A G 17: 18,052,321 (GRCm39) N87S possibly damaging Het
Spata31e5 C T 1: 28,817,225 (GRCm39) C269Y possibly damaging Het
Speer1h T A 5: 11,647,646 (GRCm39) M128K probably damaging Het
Stab2 A T 10: 86,709,728 (GRCm39) V1639E probably damaging Het
Thpo T C 16: 20,544,525 (GRCm39) N235S possibly damaging Het
Tmem63b T A 17: 45,971,722 (GRCm39) H831L probably benign Het
Tomm20l T C 12: 71,158,241 (GRCm39) V8A probably benign Het
Trav13-5 A G 14: 54,032,918 (GRCm39) R3G possibly damaging Het
Vill T C 9: 118,887,547 (GRCm39) S104P probably damaging Het
Other mutations in Fst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Fst APN 13 114,590,896 (GRCm39) missense probably damaging 1.00
IGL02213:Fst APN 13 114,592,390 (GRCm39) missense possibly damaging 0.51
R0631:Fst UTSW 13 114,591,038 (GRCm39) missense possibly damaging 0.91
R1391:Fst UTSW 13 114,590,815 (GRCm39) critical splice donor site probably benign
R4884:Fst UTSW 13 114,590,920 (GRCm39) missense probably damaging 1.00
R5326:Fst UTSW 13 114,592,241 (GRCm39) missense probably damaging 1.00
R5542:Fst UTSW 13 114,592,241 (GRCm39) missense probably damaging 1.00
R6700:Fst UTSW 13 114,595,043 (GRCm39) missense probably benign 0.00
R7319:Fst UTSW 13 114,595,068 (GRCm39) missense probably benign 0.09
R8830:Fst UTSW 13 114,592,364 (GRCm39) missense probably damaging 1.00
R8910:Fst UTSW 13 114,590,245 (GRCm39) intron probably benign
R9533:Fst UTSW 13 114,592,397 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGTGGCTTTTCAGGAGG -3'
(R):5'- CCAGAAGATGCCGTTTGAAATG -3'

Sequencing Primer
(F):5'- TGGTTAGCCCCCACACTATTAAATC -3'
(R):5'- CAGAAGATGCCGTTTGAAATGTCATC -3'
Posted On 2020-07-28