Mutagenetix > Incidental Mutation

Incidental Mutation 'R8281:Rbp3'

638216

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

067704-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R8281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33956363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 756 (K756R)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035695
AA Change: K756R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: K756R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	T	A	5: 24,549,010	H417L	probably benign	Het
Adam7	G	A	14: 68,507,885	T630I	possibly damaging	Het
Adgrf3	T	C	5: 30,197,303	S576G	possibly damaging	Het
Asxl1	A	G	2: 153,399,401	R625G	probably damaging	Het
Atp1a1	A	G	3: 101,579,624	F916L	probably benign	Het
Axl	C	T	7: 25,763,954	D633N	probably benign	Het
B230359F08Rik	A	G	14: 53,795,461	R3G	possibly damaging	Het
Chd9	A	G	8: 91,036,597	D2350G	probably damaging	Het
Cic	G	A	7: 25,271,824	V327I	probably benign	Het
Crym	T	A	7: 120,202,027		probably benign	Het
Cyp3a13	G	C	5: 137,894,297	S495C	probably benign	Het
D5Ertd579e	A	T	5: 36,613,320	F137I		Het
Dip2a	T	C	10: 76,276,604	T1087A	probably damaging	Het
Drc7	G	A	8: 95,062,177	E288K	possibly damaging	Het
Epb41l4a	T	C	18: 33,878,945	E174G	probably damaging	Het
Ern2	T	C	7: 122,170,260	R848G	probably damaging	Het
F13b	G	T	1: 139,510,951	R364S	probably benign	Het
F2rl1	A	G	13: 95,514,077	L99P	probably damaging	Het
Fam193a	C	A	5: 34,443,436	N171K	unknown	Het
Fst	A	G	13: 114,455,241	S201P	probably benign	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Gm597	C	T	1: 28,778,144	C269Y	possibly damaging	Het
Gm6460	T	A	5: 11,597,679	M128K	probably damaging	Het
Gm8232	A	G	14: 44,437,091	I182V		Het
Gm8251	T	G	1: 44,056,538	D1800A	possibly damaging	Het
Kalrn	C	T	16: 34,035,061	W1956*	probably null	Het
Klk1b16	A	G	7: 44,141,547	M258V	probably benign	Het
Lta4h	G	T	10: 93,453,594	D29Y	probably damaging	Het
March7	C	T	2: 60,234,529	S383L	probably benign	Het
Mob3c	T	C	4: 115,831,438	I56T	probably benign	Het
Msl2	T	C	9: 101,101,695	S423P	probably benign	Het
Otop3	T	C	11: 115,345,075	I511T	possibly damaging	Het
Pbld2	T	G	10: 63,048,026	L90R	probably damaging	Het
Pcdh8	A	G	14: 79,769,479	V548A	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Plch2	T	A	4: 155,006,973	M228L	probably benign	Het
Prkdc	T	C	16: 15,705,253	C1180R	probably damaging	Het
Rasl2-9	A	T	7: 5,125,352	L193*	probably null	Het
Rp1	T	C	1: 4,347,916	E991G	probably damaging	Het
Slc12a7	G	A	13: 73,790,677	R191H	probably damaging	Het
Spaca6	A	G	17: 17,832,059	N87S	possibly damaging	Het
Stab2	A	T	10: 86,873,864	V1639E	probably damaging	Het
Thpo	T	C	16: 20,725,775	N235S	possibly damaging	Het
Tmem63b	T	A	17: 45,660,796	H831L	probably benign	Het
Tomm20l	T	C	12: 71,111,467	V8A	probably benign	Het
Vill	T	C	9: 119,058,479	S104P	probably damaging	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
R8552:Rbp3	UTSW	14	33955664	missense	probably benign	0.01
R8717:Rbp3	UTSW	14	33956438	missense	probably damaging	0.99
R8730:Rbp3	UTSW	14	33955838	missense	probably benign
R8773:Rbp3	UTSW	14	33962535	missense	possibly damaging	0.71
R8836:Rbp3	UTSW	14	33958631	missense	possibly damaging	0.95
R8843:Rbp3	UTSW	14	33954565	missense	probably benign
R8880:Rbp3	UTSW	14	33956839	missense	probably benign	0.16
R8941:Rbp3	UTSW	14	33956529	missense	possibly damaging	0.92
R8971:Rbp3	UTSW	14	33955835	missense	probably damaging	1.00
R8998:Rbp3	UTSW	14	33962403	nonsense	probably null
R8999:Rbp3	UTSW	14	33962403	nonsense	probably null
R9436:Rbp3	UTSW	14	33955277	missense	possibly damaging	0.94
R9525:Rbp3	UTSW	14	33954445	missense	probably benign	0.00
R9563:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9564:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9723:Rbp3	UTSW	14	33955517	missense	possibly damaging	0.92
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CTTCAGGAGGTATCTGAGGACC -3'
(R):5'- TTTCTGTGACCCTAGATGTCGC -3'

Sequencing Primer
(F):5'- ACCGCCTGCTGGTATTCCATAG -3'
(R):5'- TAGATGTCGCCCTGTCAAAAAC -3'

Posted On

2020-07-28