Incidental Mutation 'R8281:Gm10110'
List |< first << previous [record 22 of 48] next >> last >|
ID638221
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89898241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000079967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
AA Change: V76M
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093
AA Change: V76M

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R0966:Gm10110 UTSW 14 89898119 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R1839:Gm10110 UTSW 14 89897836 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6333:Gm10110 UTSW 14 89898297 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
R8235:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8236:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8237:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8282:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8283:Gm10110 UTSW 14 89898241 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGAACAAAAGCATAGCCCTTAGAG -3'
(R):5'- ATGGCCTCCTTATACGTGGG -3'

Sequencing Primer
(F):5'- AGCATAGCCCTTAGAGCCGTTC -3'
(R):5'- GCGATTTGCACTCGGACGTC -3'
Posted On2020-07-28