Incidental Mutation 'R8281:Tmem63b'
ID638226
Institutional Source Beutler Lab
Gene Symbol Tmem63b
Ensembl Gene ENSMUSG00000036026
Gene Nametransmembrane protein 63b
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8281 (G1)
Quality Score207.009
Status Not validated
Chromosome17
Chromosomal Location45660171-45686905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45660796 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 831 (H831L)
Ref Sequence ENSEMBL: ENSMUSP00000109151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably benign
Transcript: ENSMUST00000113523
AA Change: H831L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026
AA Change: H831L

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Drc7 G A 8: 95,062,177 E288K possibly damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Tmem63b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Tmem63b APN 17 45663571 missense probably damaging 1.00
IGL02486:Tmem63b APN 17 45673983 missense probably damaging 0.97
IGL02519:Tmem63b APN 17 45665208 missense possibly damaging 0.46
IGL02893:Tmem63b APN 17 45661900 missense probably damaging 1.00
IGL03137:Tmem63b APN 17 45664995 missense probably damaging 0.98
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0276:Tmem63b UTSW 17 45675373 splice site probably benign
R0441:Tmem63b UTSW 17 45666315 critical splice donor site probably null
R0729:Tmem63b UTSW 17 45674134 missense probably damaging 1.00
R0749:Tmem63b UTSW 17 45666115 missense possibly damaging 0.89
R0834:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0835:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0865:Tmem63b UTSW 17 45661519 missense probably benign 0.02
R1144:Tmem63b UTSW 17 45666427 missense probably benign 0.07
R1448:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1538:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1853:Tmem63b UTSW 17 45661297 missense possibly damaging 0.68
R1935:Tmem63b UTSW 17 45678961 critical splice donor site probably null
R2078:Tmem63b UTSW 17 45663536 missense possibly damaging 0.91
R2518:Tmem63b UTSW 17 45666154 missense probably benign
R3911:Tmem63b UTSW 17 45677958 missense probably damaging 1.00
R5093:Tmem63b UTSW 17 45660874 missense probably damaging 1.00
R5186:Tmem63b UTSW 17 45661477 missense possibly damaging 0.68
R5364:Tmem63b UTSW 17 45664727 unclassified probably benign
R5396:Tmem63b UTSW 17 45669962 missense possibly damaging 0.72
R5548:Tmem63b UTSW 17 45664958 missense probably damaging 0.98
R5582:Tmem63b UTSW 17 45667763 missense probably benign
R5998:Tmem63b UTSW 17 45670000 missense possibly damaging 0.94
R6198:Tmem63b UTSW 17 45661516 missense probably benign 0.00
R6656:Tmem63b UTSW 17 45667708 missense probably benign
R6808:Tmem63b UTSW 17 45660808 missense probably benign 0.13
R6967:Tmem63b UTSW 17 45666632 missense probably benign 0.00
R7089:Tmem63b UTSW 17 45667783 missense probably benign 0.00
R7181:Tmem63b UTSW 17 45673168 missense probably benign 0.00
R7214:Tmem63b UTSW 17 45661822 missense probably benign 0.02
R7267:Tmem63b UTSW 17 45666122 missense probably benign
R7323:Tmem63b UTSW 17 45660847 missense possibly damaging 0.86
R7346:Tmem63b UTSW 17 45666591 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTGGTGAAATCCCCAGG -3'
(R):5'- TACATTGCTGGCAGGTCCTAC -3'

Sequencing Primer
(F):5'- GGTGAAATCCCCAGGTTTAAATACC -3'
(R):5'- AATACATCGCTCAGGTGCTG -3'
Posted On2020-07-28