Incidental Mutation 'R8282:Kdsr'
ID638228
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R8282 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106724997 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably benign
Transcript: ENSMUST00000010049
AA Change: T302A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: T302A

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Adcy10 T A 1: 165,510,337 D173E probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Col14a1 A G 15: 55,420,880 T846A unknown Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam46c A G 3: 100,473,011 V143A probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Slc6a3 T A 13: 73,557,081 D230E probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Vmn2r56 A T 7: 12,715,674 Y212* probably null Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R0361:Kdsr UTSW 1 106747787 missense probably damaging 0.97
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R1679:Kdsr UTSW 1 106753226 missense probably benign 0.01
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106755442 critical splice donor site probably null
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R8312:Kdsr UTSW 1 106747486 critical splice donor site probably null
R8392:Kdsr UTSW 1 106743853 missense probably damaging 1.00
R8507:Kdsr UTSW 1 106743670 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTCCAATCTCACACATTC -3'
(R):5'- CCACTGTACAAAGCAGACGTATTC -3'

Sequencing Primer
(F):5'- TACAAAAGTCTGGAGGCCAAAACTTG -3'
(R):5'- ATTCTGTTCTTGAGAATTACTGGC -3'
Posted On2020-07-28