Incidental Mutation 'R0724:Hand1'
ID63823
Institutional Source Beutler Lab
Gene Symbol Hand1
Ensembl Gene ENSMUSG00000037335
Gene Nameheart and neural crest derivatives expressed 1
SynonymsHxt, Th1, eHAND, bHLHa27, Ehand1, Thing1
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score122
Status Validated
Chromosome11
Chromosomal Location57828705-57832818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57831680 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 36 (H36R)
Ref Sequence ENSEMBL: ENSMUSP00000124951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036917] [ENSMUST00000108845] [ENSMUST00000160392]
Predicted Effect probably damaging
Transcript: ENSMUST00000036917
AA Change: H36R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046999
Gene: ENSMUSG00000037335
AA Change: H36R

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 49 78 N/A INTRINSIC
HLH 100 152 1.03e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108845
Predicted Effect probably damaging
Transcript: ENSMUST00000160392
AA Change: H36R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124951
Gene: ENSMUSG00000037335
AA Change: H36R

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 49 78 N/A INTRINSIC
HLH 100 152 1.03e-16 SMART
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 8.5-9.5 with yolk sac abnormalities associated with a deficiency of extraembryonic mesoderm and defective trophoblast differentiation. Tetraploid chimeric rescue slightly extends development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Hand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Hand1 APN 11 57831749 missense probably damaging 1.00
IGL02484:Hand1 APN 11 57831594 missense probably benign
R4778:Hand1 UTSW 11 57831623 missense possibly damaging 0.62
R4934:Hand1 UTSW 11 57831252 missense possibly damaging 0.91
R5212:Hand1 UTSW 11 57831447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAACGCGCTGTTAATGCTCTC -3'
(R):5'- TTGCTCGCTCAGGACTCTCCAAAC -3'

Sequencing Primer
(F):5'- GTTAATGCTCTCTGTGCGTC -3'
(R):5'- AGCCAGTTCGCTGCCTC -3'
Posted On2013-07-30